Cellosaurus logo
expasy logo

Cellosaurus MM1.S (CVCL_8792)

[Text][XML][JSON]
Cell line name MM1.S
Synonyms MM.1S; MM1-S; MM-1S; MM1S
Accession CVCL_8792
Resource Identification Initiative To cite this cell line use: MM1.S (RRID:CVCL_8792)
Comments Part of: Cancer Dependency Map project (DepMap) (includes Cancer Cell Line Encyclopedia - CCLE).
Part of: COSMIC cell lines project.
Part of: MD Anderson Cell Lines Project.
Population: African American.
Characteristics: Produces IgA lambda (ATCC=CRL-2974).
Characteristics: Sensitive to dexamethasone.
Doubling time: 80 hours (PubMed=25984343); ~72 hours (ATCC=CRL-2974).
Microsatellite instability: Instable (MSI-low) (Sanger).
Omics: Genomics; DNA methylation analysis.
Omics: Genomics; Whole exome sequencing.
Omics: Phenotyping; CRISPR screening.
Omics: Phenotyping; Drug screening.
Omics: Phenotyping; shRNA library screening.
Omics: Proteomics; Expression; Reverse-phase protein array.
Omics: Proteomics; Quantitative.
Omics: Transcriptomics; Microarray.
Omics: Transcriptomics; RNAseq.
Omics: Variations; Array-based CGH.
Omics: Variations; SNP array analysis.
Derived from site: In situ; Peripheral blood; UBERON=UBERON_0000178.
Cell type: Plasma cell; CL=CL_0000786.
Sequence variations
  • Mutation; HGNC; HGNC:6407; KRAS; Simple; p.Gly12Ala (c.35G>C); ClinVar=VCV000045122; Zygosity=Heterozygous (PubMed=21173094; Cosmic-CLP=1659818; DepMap=ACH-000763).
  • Mutation; HGNC; HGNC:12033; TRAF3; Simple; p.Val536_Asn545delValPheValAlaGlnThrValLeuGluAsninsAsp (c.1604-1630delTCTTTGTGGCCCAAACTGTTCTAGAAA); Zygosity=Homozygous (PubMed=17692805).
HLA typing Source: PubMed=25688540
Class I
HLA-AA*23,24
HLA-BB*18,42
HLA-CC*12,17

Source: PubMed=26589293
Class I
HLA-AA*23:01,24:02
HLA-BB*18:01,42:01
HLA-CC*12:03,17:01
Genome ancestry Source: PubMed=30894373

Origin% genome
African88.68
Native American0
East Asian, North4.01
East Asian, South0
South Asian0.43
European, North0
European, South6.87
Disease Plasma cell myeloma (NCIt: C3242)
Multiple myeloma (ORDO: Orphanet_29073)
Species of origin Homo sapiens (Human) (NCBI Taxonomy: 9606)
Hierarchy Parent: CVCL_5801 (MM.1)
Children:
CVCL_E8DM (BPS Bioscience MM.1S TNFRSF17 KO)CVCL_E3I2 (HyCyte MM.1S-Luc-GFP)CVCL_B7F7 (MM.1S-luc)
Sex of cell Female
Age at sampling 45Y
Category Cancer cell line
STR profile Source(s): ATCC=CRL-2974; Cosmic-CLP=1659818; PubMed=25877200; Technion Genomics Center

Markers:
AmelogeninX
CSF1PO9,14
D1S165611,12
D2S44111
D2S133821,22
D3S135816,17
D5S8188,12
D7S82010,11
D8S117914
D10S124812,15
D12S39117,24
D13S31713
D16S53912
D18S5111,16
D19S43313
D21S1129,30
D22S104510,11
FGA20,24
Penta D2.2,9
Penta E13,15
TH017,8
TPOX8
vWA15,17

Run an STR similarity search on this cell line
Web pages Info; ATCC; -; https://www.atcc.org/en/support/technical-support/faqs/morphology-of-item-mm-1s-atcc-crl-2974
Info; Keats Lab; -; https://www.keatslab.org/myeloma-cell-lines
Info; MCLP; -; https://tcpaportal.org/mclp/
Publications

PubMed=12691914; DOI=10.1016/S0301-472X(03)00023-7
Stephanie Greenstein, Nancy L. Krett, Yoshihiro Kurosawa, Chun-Guang Ma, Dharminder Chauhan, Teru Hideshima, Kenneth Carl Anderson, Steven T. Rosen;
Characterization of the MM.1 human multiple myeloma (MM) cell lines: a model system to elucidate the characteristics, behavior, and signaling of steroid-sensitive and -resistant MM cells.
Exp. Hematol. 31:271-282(2003)

PubMed=14760100; DOI=10.1158/1078-0432.CCR-0793-03
Masood A. Shammas, Robert Joseph Shmookler Reis, Cheng Li, Hemanta Koley, Laurence H. Hurley, Kenneth Carl Anderson, Nikhil C. Munshi;
Telomerase inhibition and cell growth arrest after telomestatin treatment in multiple myeloma.
Clin. Cancer Res. 10:770-776(2004)

PubMed=16956823
Francois-Regis Bataille, Gaatan Jego, Nelly Robillard, Sophie Barille-Nion, Jean-Luc Harousseau, Philippe Moreau, Martine Amiot, Catherine Pellat-Deceunynck;
The phenotype of normal, reactive and malignant plasma cells Identification of 'many and multiple myelomas' and of new targets for myeloma therapy.
Haematologica 91:1234-1240(2006)

PubMed=17692805; DOI=10.1016/j.ccr.2007.07.003; PMCID=PMC2083698
Jonathan J. Keats, Rafael Fonseca, Marta Chesi, Roelandt Schop, Angela Baker, Wee-Joo Chng, Scott Van Wier, Rodger Tiedemann, Chang-Xin Shi, Michael Sebag, Esteban Braggio ...Show all 30 authors... , Travis Henry, Yuan-Xiao Zhu, Homer Fogle, Tammy L. Price-Troska, Gregory J. Ahmann, Catherine Mancini, Leslie A. Brents, Shaji K. Kumar, Philip Robert Greipp, Angela Dispenzieri, Barb Bryant, George Mulligan, Laurakay Bruhn, Michael T. Barrett, Riccardo Valdez, Jeffrey M. Trent, A. Keith Stewart, John D. Carpten, Peter Leif Bergsagel; Show fewer authors
Promiscuous mutations activate the noncanonical NF-kappaB pathway in multiple myeloma.
Cancer Cell 12:131-144(2007)

PubMed=18647998; DOI=10.1093/jncimonographs/lgn011; PMCID=PMC2737184
Amel Dib, Ana Gabrea, Oleg K. Glebov, Peter Leif Bergsagel, Walter Michael Kuehl;
Characterization of MYC translocations in multiple myeloma cell lines.
J. Natl. Cancer Inst. Monogr. 39:25-31(2008)

PubMed=21173094; DOI=10.3324/haematol.2010.033456; PMCID=PMC3069235
Jerome Moreaux, Bernard Klein, Francois-Regis Bataille, Geraldine Descamps, Sophie Maiga, Dirk Hose, Hartmut Goldschmidt, Anna Jauch, Thierry Reme, Michel Jourdan, Martine Amiot, Catherine Pellat-Deceunynck;
A high-risk signature for patients with multiple myeloma established from the molecular classification of human myeloma cell lines.
Haematologica 96:574-582(2011)

PubMed=22460905; DOI=10.1038/nature11003; PMCID=PMC3320027
Jordi Ginesta Barretina, Giordano Caponigro, Nicolas Stransky, Kavitha Venkatesan, Adam A. Margolin, Sungjoon Kim, Christopher J. Wilson, Joseph Lehar, Gregory V. Kryukov, Dmitriy Sonkin, Anupama Reddy ...Show all 61 authors... , Manway Liu, Lauren Murray, Michael F. Berger, John E. Monahan, Paula Morais, Jodi Meltzer, Adam Korejwa, Judit Jane-Valbuena, Felipa A. Mapa, Joseph Thibault, Eva Bric-Furlong, Pichai Raman, Aaron Shipway, Ingo H. Engels, Jill Cheng, Guo-Ying K. Yu, Jian-Jun Yu, Peter Aspesi Jr., Melanie de Silva, Kalpana Jagtap, Michael D. Jones, Li Wang, Charles Hatton, Emanuele Palescandolo, Supriya Gupta, Scott Mahan, Carrie Sougnez, Robert C. Onofrio, Ted Liefeld, Laura Eleanor MacConaill, Wendy Winckler, Michael Reich, Nan-Xin Li, Jill P. Mesirov, Stacey B. Gabriel, Gad Getz, Kristin Ardlie, Vivien Chan, Vic E. Myer, Barbara L. Weber, Jeff Porter, Markus Warmuth, Peter Finan, Jennifer L. Harris, Matthew Langer Meyerson, Todd Robert Golub, Michael P. Morrissey, William Raj Sellers, Robert Schlegel, Levi Alexander Garraway; Show fewer authors
The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug sensitivity.
Nature 483:603-607(2012)

PubMed=25984343; DOI=10.1038/sdata.2014.35; PMCID=PMC4432652
Glenn S. Cowley, Barbara A. Weir, Francisca Vazquez, Pablo Tamayo, Justine A. Scott, Scott Rusin, Alexandra East-Seletsky, Levi D. Ali, William F.J. Gerath, Sarah E. Pantel, Patrick Hall Lizotte ...Show all 40 authors... , Guo-Zhi Jiang, Jessica Hsiao, Aviad Tsherniak, Elizabeth Dwinell, Simon Aoyama, Michael Okamoto, William Harrington, Ellen T. Gelfand, Thomas M. Green, Mark J. Tomko, Shuba Gopal, Terence C. Wong, Hu-Bo Li, Sara Howell, Nicolas Stransky, Ted Liefeld, Dongkeun Jang, Jonathan Bistline, Barbara Hill Meyers, Scott Allen Armstrong, Kenneth Carl Anderson, Kimberly Stegmaier, Michael Reich, David Pellman, Jesse S. Boehm, Jill P. Mesirov, Todd Robert Golub, David E. Root, William Chun Hahn; Show fewer authors
Parallel genome-scale loss of function screens in 216 cancer cell lines for the identification of context-specific genetic dependencies.
Sci. Data 1:140035.1-140035.12(2014)

PubMed=25485619; DOI=10.1038/nbt.3080
Christiaan Klijn, Steffen Durinck, Eric W. Stawiski, Peter M. Haverty, Zhao-Shi Jiang, Han-Bin Liu, Jeremiah Degenhardt, Oleg Mayba, Florian Gnad, Jin-Feng Liu, Gregoire Pau ...Show all 30 authors... , Jens Reeder, Yi Cao, Kiran Mukhyala, Suresh K. Selvaraj, Ma-Mie Yu, Gregory J. Zynda, Matthew J. Brauer, Thomas D. Wu, Robert Clifford Gentleman, Gerard Manning, Robert L. Yauch, Richard Bourgon, David Stokoe, Zora Modrusan, Richard M. Neve, Frederic J. de Sauvage, Jeffrey Settleman, Somasekar Seshagiri, Ze-Min Zhang; Show fewer authors
A comprehensive transcriptional portrait of human cancer cell lines.
Nat. Biotechnol. 33:306-312(2015)

PubMed=25688540; DOI=10.1002/cyto.a.22643
Sophie Maiga, Carole Brosseau, Geraldine Descamps, Christelle Dousset, Patricia Gomez-Bougie, David Chiron, Emmanuelle Menoret, Charlotte Kervoelen, Henri Vie, Anne Cesbron, Agnes Moreau-Aubry ...Show all 13 authors... , Martine Amiot, Catherine Pellat-Deceunynck; Show fewer authors
A simple flow cytometry-based barcode for routine authentication of multiple myeloma and mantle cell lymphoma cell lines.
Cytometry A 87:285-288(2015)

PubMed=25877200; DOI=10.1038/nature14397
Ma-Mie Yu, Suresh K. Selvaraj, May M.Y. Liang-Chu, Sahar Aghajani, Matthew Busse, Jean Yuan, Genee Lee, Franklin V. Peale, Christiaan Klijn, Richard Bourgon, Joshua S. Kaminker, Richard M. Neve;
A resource for cell line authentication, annotation and quality control.
Nature 520:307-311(2015)

PubMed=26589293; DOI=10.1186/s13073-015-0240-5; PMCID=PMC4653878
Jelle Scholtalbers, Sebastian Boegel, Thomas Bukur, Marius Byl, Sebastian Goerges, Patrick Sorn, Martin Loewer, Ugur Sahin, John C. Castle;
TCLP: an online cancer cell line catalogue integrating HLA type, predicted neo-epitopes, virus and gene expression.
Genome Med. 7:118.1-118.7(2015)

PubMed=27397505; DOI=10.1016/j.cell.2016.06.017; PMCID=PMC4967469
Francesco Iorio, Theo A. Knijnenburg, Daniel J. Vis, Graham Robert Bignell, Michael Patrick Menden, Michael Schubert, Nanne Aben, Emanuel Goncalves, Syd Barthorpe, Howard Lightfoot, Thomas Cokelaer ...Show all 39 authors... , Patricia Greninger, Ewald van Dyk, Han Chang, Heshani de Silva, Holger Heyn, Xian-Ming Deng, Regina K. Egan, Qing-Song Liu, Tatiana Mironenko, Xeni Mitropoulos, Laura Richardson, Jin-Hua Wang, Ting-Hu Zhang, Sebastian Moran, Sergi Sayols, Maryam Soleimani, David Tamborero, Nuria Lopez-Bigas, Petra Ross-Macdonald, Manel Esteller, Nathanael S. Gray, Daniel Arie Haber, Michael Rudolf Stratton, Cyril Henri Benes, Lodewyk F.A. Wessels, Julio Saez-Rodriguez, Ultan McDermott, Mathew J. Garnett; Show fewer authors
A landscape of pharmacogenomic interactions in cancer.
Cell 166:740-754(2016)

CLPUB00604
Sharon Chow;
Targeted capture and sequencing of immunoglobulin rearrangements in multiple myeloma to enable detection of minimal residual disease.
Thesis MSc (2017); University of Toronto; Toronto; Canada

PubMed=28196595; DOI=10.1016/j.ccell.2017.01.005; PMCID=PMC5501076
Jun Li, Wei Zhao, Rehan Akbani, Wen-Bin Liu, Zhen-Lin Ju, Shi-Yun Ling, Christopher P. Vellano, Paul Roebuck, Qing-Hua Yu, Agda Karina Eterovic, Lauren Averett Byers ...Show all 25 authors... , Michael A. Davies, Wan-Leng Deng, Y.N. Vashisht Gopal, Guo Chen, Erika Maria von Euw, Dennis Joseph Slamon, Dylan Conklin, John Victor Heymach, Adi F. Gazdar, John D. Minna, Jeffrey N. Myers, Yi-Ling Lu, Gordon B. Mills, Han Liang; Show fewer authors
Characterization of human cancer cell lines by reverse-phase protein arrays.
Cancer Cell 31:225-239(2017)

PubMed=30285677; DOI=10.1186/s12885-018-4840-5; PMCID=PMC6167786
Kar-Tong Tan, Ling-Wen Ding, Qiao-Yang Sun, Zhen-Tang Lao, Wenwen Chien, Xi Ren, Jin-Fen Xiao, Xin-Yi Loh, Liang Xu, Michael Lill, Anand Mayakonda ...Show all 14 authors... , De-Chen Lin, Henry He Yang, Harold Phillip Koeffler; Show fewer authors
Profiling the B/T cell receptor repertoire of lymphocyte derived cell lines.
BMC Cancer 18:940.1-940.13(2018)

PubMed=30545397; DOI=10.1186/s13045-018-0679-0; PMCID=PMC6293660
Benoit Tessoulin, Agnes Moreau-Aubry, Geraldine Descamps, Patricia Gomez-Bougie, Sophie Maiga, Alban Gaignard, David Chiron, Emmanuelle Menoret, Steven Le Gouill, Philippe Moreau, Martine Amiot, Catherine Pellat-Deceunynck;
Whole-exon sequencing of human myeloma cell lines shows mutations related to myeloma patients at relapse with major hits in the DNA regulation and repair pathways.
J. Hematol. Oncol. 11:137.1-137.13(2018)

PubMed=30894373; DOI=10.1158/0008-5472.CAN-18-2747; PMCID=PMC6445675
Julie Dutil, Zhi-Hua Chen, Alvaro N.A. Monteiro, Jamie K. Teer, Steven A. Eschrich;
An interactive resource to probe genetic diversity and estimated ancestry in cancer cell lines.
Cancer Res. 79:1263-1273(2019)

PubMed=30971826; DOI=10.1038/s41586-019-1103-9
Fiona M. Behan, Francesco Iorio, Gabriele Picco, Emanuel Goncalves, Charlotte M. Beaver, Giorgia Migliardi, Rita Santos, Yanhua Rao, Francesco Sassi, Marika Pinnelli, Rizwan Ansari ...Show all 25 authors... , Sarah Harper, David Adam Jackson, Rebecca McRae, Rachel Pooley, Piers Wilkinson, Dieudonne J. van der Meer, David Dow, Carolyn A. Buser-Doepner, Andrea Bertotti, Livio Trusolino, Euan Alexander Stronach, Julio Saez-Rodriguez, Kosuke Yusa, Mathew J. Garnett; Show fewer authors
Prioritization of cancer therapeutic targets using CRISPR-Cas9 screens.
Nature 568:511-516(2019)

PubMed=31068700; DOI=10.1038/s41586-019-1186-3; PMCID=PMC6697103
Mahmoud Ghandi, Franklin W. Huang, Judit Jane-Valbuena, Gregory V. Kryukov, Christopher C. Lo, E. Robert McDonald 3rd, Jordi Ginesta Barretina, Ellen T. Gelfand, Craig M. Bielski, Hao-Xin Li, Kevin Hu ...Show all 68 authors... , Alexander Y. Andreev-Drakhlin, Jaegil Kim, Julian M. Hess, Brian J. Haas, Francois Aguet, Barbara A. Weir, Michael V. Rothberg, Brenton R. Paolella, Michael Scott Lawrence, Rehan Akbani, Yi-Ling Lu, Hong L. Tiv, Prafulla C. Gokhale, Antoine de Weck, Ali Amin Mansour, Coyin Oh, Juliann Shih, Kevin Hadi, Yanay Rosen, Jonathan Bistline, Kavitha Venkatesan, Anupama Reddy, Dmitriy Sonkin, Manway Liu, Joseph Lehar, Joshua M. Korn, Dale A. Porter, Michael D. Jones, Javad Golji, Giordano Caponigro, Jordan E. Taylor, Caitlin M. Dunning, Amanda L. Creech, Allison C. Warren, James M. McFarland, Mahdi Zamanighomi, Audrey Kauffmann, Nicolas Stransky, Marcin Imielinski, Yosef E. Maruvka, Andrew D. Cherniack, Aviad Tsherniak, Francisca Vazquez, Jacob D. Jaffe, Andrew Alan Lane, David M. Weinstock, Cory M. Johannessen, Michael P. Morrissey, Frank Stegmeier, Robert Schlegel, William Chun Hahn, Gad Getz, Gordon B. Mills, Jesse S. Boehm, Todd Robert Golub, Levi Alexander Garraway, William Raj Sellers; Show fewer authors
Next-generation characterization of the Cancer Cell Line Encyclopedia.
Nature 569:503-508(2019)

PubMed=32123307; DOI=10.1038/s41375-020-0785-1; PMCID=PMC7483300
Vishesh Sarin, Katharine Yu, Ian D. Ferguson, Olivia Gugliemini, Matthew A. Nix, Byron Hann, Marina Sirota, Arun P. Wiita;
Evaluating the efficacy of multiple myeloma cell lines as models for patient tumors via transcriptomic correlation analysis.
Leukemia 34:2754-2765(2020)

PubMed=35839778; DOI=10.1016/j.ccell.2022.06.010; PMCID=PMC9387775
Emanuel Goncalves, Rebecca C. Poulos, Zhao-Xiang Cai, Syd Barthorpe, Srikanth S. Manda, Natasha Lucas, Alexandra Beck, Daniel Bucio-Noble, Michael Dausmann, Caitlin Hall, Michael Hecker ...Show all 32 authors... , Jennifer Koh, Howard Lightfoot, Sadia Mahboob, Iman Mali, James Morris, Laura Richardson, Akila J. Seneviratne, Rebecca Shepherd, Erin Sykes, Frances Thomas, Sara Valentini, Steven G. Williams, Yang-Xiu Wu, Dylan Xavier, Karen L. MacKenzie, Peter G. Hains, Brett Tully, Phillip James Robinson, Qing Zhong, Mathew J. Garnett, Roger Robert Reddel; Show fewer authors
Pan-cancer proteomic map of 949 human cell lines.
Cancer Cell 40:835-849.e8(2022)

Cross-references
Cell line collections (Providers) ATCC; CRL-2974
CLS; 305304
IZSLER; BS TCL 237
Cell line databases/resources CLO; CLO_0037203
cancercelllines; CVCL_8792
CCRID; 1101HUM-PUMC000680
CCRID; 3101HUMSCSP5017
Cell_Model_Passport; SIDM01265
Cosmic-CLP; 1659818
DepMap; ACH-000763
Lonza; 168
Anatomy/cell type resources BTO; BTO_0003933
Biological sample resources BioSample; SAMN03471684
BioSample; SAMN10988254
ENCODE; ENCBS205VYW
ENCODE; ENCBS241TLI
ENCODE; ENCBS299YQN
ENCODE; ENCBS523NFL
ENCODE; ENCBS981ZAE
CRISP screens repositories BioGRID_ORCS_Cell_line; 801
Chemistry resources ChEMBL-Cells; CHEMBL4295490
ChEMBL-Targets; CHEMBL4296471
GDSC; 1659818
PharmacoDB; MM1S_944_2019
PubChem_Cell_line; CVCL_8792
Encyclopedic resources Wikidata; Q54906038
Experimental variables resources EFO; EFO_0005724
Gene expression databases ArrayExpress; E-MTAB-2706
ArrayExpress; E-MTAB-2770
ArrayExpress; E-MTAB-3610
ArrayExpress; E-TABM-1088
GEO; GSM562814
GEO; GSM887328
GEO; GSM888404
GEO; GSM1374685
GEO; GSM1666388
GEO; GSM1670118
Polymorphism and mutation databases Cosmic; 1424218
Cosmic; 1483077
Cosmic; 1762460
Cosmic; 1889512
Cosmic; 2081430
Cosmic; 2391805
Cosmic; 2809756
IARC_TP53; 28513
LiGeA; CCLE_132
Progenetix; CVCL_8792
Proteomic databases PRIDE; PXD021265
PRIDE; PXD030304
Sequence databases EGA; EGAS00001000610
EGA; EGAS00001000978
Entry history
Entry creation06-Jun-2012
Last entry update14-Aug-2025
Version number39