Cellosaurus logo
expasy logo

Cellosaurus MM1.S (CVCL_8792)

[Text version]
Cell line name MM1.S
Synonyms MM.1S; MM1-S; MM-1S; MM1S
Accession CVCL_8792
Resource Identification Initiative To cite this cell line use: MM1.S (RRID:CVCL_8792)
Comments Part of: Cancer Dependency Map project (DepMap) (includes Cancer Cell Line Encyclopedia - CCLE).
Part of: COSMIC cell lines project.
Part of: MD Anderson Cell Lines Project.
Population: African American.
Characteristics: Produces IgA lambda (ATCC=CRL-2974).
Characteristics: Sensitive to dexamethasone.
Doubling time: 80 hours (PubMed=25984343); ~72 hours (ATCC=CRL-2974).
Microsatellite instability: Instable (MSI-low) (Sanger).
Omics: Genomics; DNA methylation analysis.
Omics: Genomics; Whole exome sequencing.
Omics: Phenotyping; CRISPR screening.
Omics: Phenotyping; Drug screening.
Omics: Phenotyping; shRNA library screening.
Omics: Proteomics; Expression; Reverse-phase protein array.
Omics: Proteomics; Quantitative.
Omics: Transcriptomics; Microarray.
Omics: Transcriptomics; RNAseq.
Omics: Variations; Array-based CGH.
Omics: Variations; SNP array analysis.
Derived from site: In situ; Peripheral blood; UBERON=UBERON_0000178.
Cell type: B-cell; CL=CL_0000236.
Sequence variations
  • Mutation; HGNC; HGNC:6407; KRAS; Simple; p.Gly12Ala (c.35G>C); ClinVar=VCV000045122; Zygosity=Heterozygous (PubMed=21173094; Cosmic-CLP=1659818; DepMap=ACH-000763).
  • Mutation; HGNC; HGNC:12033; TRAF3; Simple; p.Val536_Asn545delValPheValAlaGlnThrValLeuGluAsninsAsp (c.1604-1630delTCTTTGTGGCCCAAACTGTTCTAGAAA); Zygosity=Homozygous (PubMed=17692805).
HLA typing Source: PubMed=25688540
Class I
HLA-AA*23,24
HLA-BB*18,42
HLA-CC*12,17

Source: PubMed=26589293
Class I
HLA-AA*23:01,24:02
HLA-BB*18:01,42:01
HLA-CC*12:03,17:01
Genome ancestry Source: PubMed=30894373

Origin% genome
African88.68
Native American0
East Asian, North4.01
East Asian, South0
South Asian0.43
European, North0
European, South6.87
Disease Plasma cell myeloma (NCIt: C3242)
Multiple myeloma (ORDO: Orphanet_29073)
Species of origin Homo sapiens (Human) (NCBI Taxonomy: 9606)
Hierarchy Parent: CVCL_5801 (MM.1)
Children:
CVCL_E8DM (BPS Bioscience MM.1S TNFRSF17 KO)CVCL_E3I2 (HyCyte MM.1S-Luc-GFP)CVCL_B7F7 (MM.1S-luc)
Sex of cell Female
Age at sampling 45Y
Category Cancer cell line
STR profile Source(s): ATCC=CRL-2974; Cosmic-CLP=1659818; PubMed=25877200; Technion Genomics Center

Markers:
AmelogeninX
CSF1PO9,14
D1S165611,12
D2S44111
D2S133821,22
D3S135816,17
D5S8188,12
D7S82010,11
D8S117914
D10S124812,15
D12S39117,24
D13S31713
D16S53912
D18S5111,16
D19S43313
D21S1129,30
D22S104510,11
FGA20,24
Penta D2.2,9
Penta E13,15
TH017,8
TPOX8
vWA15,17

Run an STR similarity search on this cell line
Web pages Info; ATCC; -; https://www.atcc.org/en/support/technical-support/faqs/morphology-of-item-mm-1s-atcc-crl-2974
Info; Keats Lab; -; https://www.keatslab.org/myeloma-cell-lines
Info; MCLP; -; https://tcpaportal.org/mclp/
Publications

PubMed=12691914; DOI=10.1016/S0301-472X(03)00023-7
Greenstein S., Krett N.L., Kurosawa Y., Ma C.-G., Chauhan D., Hideshima T., Anderson K.C., Rosen S.T.
Characterization of the MM.1 human multiple myeloma (MM) cell lines: a model system to elucidate the characteristics, behavior, and signaling of steroid-sensitive and -resistant MM cells.
Exp. Hematol. 31:271-282(2003)

PubMed=14760100; DOI=10.1158/1078-0432.CCR-0793-03
Shammas M.A., Shmookler Reis R.J., Li C., Koley H., Hurley L.H., Anderson K.C., Munshi N.C.
Telomerase inhibition and cell growth arrest after telomestatin treatment in multiple myeloma.
Clin. Cancer Res. 10:770-776(2004)

PubMed=16956823
Bataille F.-R., Jego G., Robillard N., Barille-Nion S., Harousseau J.-L., Moreau P., Amiot M., Pellat-Deceunynck C.
The phenotype of normal, reactive and malignant plasma cells Identification of 'many and multiple myelomas' and of new targets for myeloma therapy.
Haematologica 91:1234-1240(2006)

PubMed=17692805; DOI=10.1016/j.ccr.2007.07.003; PMCID=PMC2083698
Keats J.J., Fonseca R., Chesi M., Schop R., Baker A., Chng W.-J., Van Wier S., Tiedemann R., Shi C.-X., Sebag M., Braggio E., Henry T., Zhu Y.-X., Fogle H., Price-Troska T.L., Ahmann G.J., Mancini C., Brents L.A., Kumar S.K., Greipp P.R., Dispenzieri A., Bryant B., Mulligan G., Bruhn L., Barrett M.T., Valdez R., Trent J.M., Stewart A.K., Carpten J.D., Bergsagel P.L.
Promiscuous mutations activate the noncanonical NF-kappaB pathway in multiple myeloma.
Cancer Cell 12:131-144(2007)

PubMed=18647998; DOI=10.1093/jncimonographs/lgn011; PMCID=PMC2737184
Dib A., Gabrea A., Glebov O.K., Bergsagel P.L., Kuehl W.M.
Characterization of MYC translocations in multiple myeloma cell lines.
J. Natl. Cancer Inst. Monogr. 39:25-31(2008)

PubMed=21173094; DOI=10.3324/haematol.2010.033456; PMCID=PMC3069235
Moreaux J., Klein B., Bataille F.-R., Descamps G., Maiga S., Hose D., Goldschmidt H., Jauch A., Reme T., Jourdan M., Amiot M., Pellat-Deceunynck C.
A high-risk signature for patients with multiple myeloma established from the molecular classification of human myeloma cell lines.
Haematologica 96:574-582(2011)

PubMed=22460905; DOI=10.1038/nature11003; PMCID=PMC3320027
Barretina J.G., Caponigro G., Stransky N., Venkatesan K., Margolin A.A., Kim S., Wilson C.J., Lehar J., Kryukov G.V., Sonkin D., Reddy A., Liu M., Murray L., Berger M.F., Monahan J.E., Morais P., Meltzer J., Korejwa A., Jane-Valbuena J., Mapa F.A., Thibault J., Bric-Furlong E., Raman P., Shipway A., Engels I.H., Cheng J., Yu G.-Y.K., Yu J.-J., Aspesi P. Jr., de Silva M., Jagtap K., Jones M.D., Wang L., Hatton C., Palescandolo E., Gupta S., Mahan S., Sougnez C., Onofrio R.C., Liefeld T., MacConaill L.E., Winckler W., Reich M., Li N.-X., Mesirov J.P., Gabriel S.B., Getz G., Ardlie K., Chan V., Myer V.E., Weber B.L., Porter J., Warmuth M., Finan P., Harris J.L., Meyerson M.L., Golub T.R., Morrissey M.P., Sellers W.R., Schlegel R., Garraway L.A.
The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug sensitivity.
Nature 483:603-607(2012)

PubMed=25984343; DOI=10.1038/sdata.2014.35; PMCID=PMC4432652
Cowley G.S., Weir B.A., Vazquez F., Tamayo P., Scott J.A., Rusin S., East-Seletsky A., Ali L.D., Gerath W.F.J., Pantel S.E., Lizotte P.H., Jiang G.-Z., Hsiao J., Tsherniak A., Dwinell E., Aoyama S., Okamoto M., Harrington W., Gelfand E.T., Green T.M., Tomko M.J., Gopal S., Wong T.C., Li H.-B., Howell S., Stransky N., Liefeld T., Jang D., Bistline J., Meyers B.H., Armstrong S.A., Anderson K.C., Stegmaier K., Reich M., Pellman D., Boehm J.S., Mesirov J.P., Golub T.R., Root D.E., Hahn W.C.
Parallel genome-scale loss of function screens in 216 cancer cell lines for the identification of context-specific genetic dependencies.
Sci. Data 1:140035.1-140035.12(2014)

PubMed=25485619; DOI=10.1038/nbt.3080
Klijn C., Durinck S., Stawiski E.W., Haverty P.M., Jiang Z.-S., Liu H.-B., Degenhardt J., Mayba O., Gnad F., Liu J.-F., Pau G., Reeder J., Cao Y., Mukhyala K., Selvaraj S.K., Yu M.-M., Zynda G.J., Brauer M.J., Wu T.D., Gentleman R.C., Manning G., Yauch R.L., Bourgon R., Stokoe D., Modrusan Z., Neve R.M., de Sauvage F.J., Settleman J., Seshagiri S., Zhang Z.-M.
A comprehensive transcriptional portrait of human cancer cell lines.
Nat. Biotechnol. 33:306-312(2015)

PubMed=25688540; DOI=10.1002/cyto.a.22643
Maiga S., Brosseau C., Descamps G., Dousset C., Gomez-Bougie P., Chiron D., Menoret E., Kervoelen C., Vie H., Cesbron A., Moreau-Aubry A., Amiot M., Pellat-Deceunynck C.
A simple flow cytometry-based barcode for routine authentication of multiple myeloma and mantle cell lymphoma cell lines.
Cytometry A 87:285-288(2015)

PubMed=25877200; DOI=10.1038/nature14397
Yu M., Selvaraj S.K., Liang-Chu M.M.Y., Aghajani S., Busse M., Yuan J., Lee G., Peale F.V., Klijn C., Bourgon R., Kaminker J.S., Neve R.M.
A resource for cell line authentication, annotation and quality control.
Nature 520:307-311(2015)

PubMed=26589293; DOI=10.1186/s13073-015-0240-5; PMCID=PMC4653878
Scholtalbers J., Boegel S., Bukur T., Byl M., Goerges S., Sorn P., Loewer M., Sahin U., Castle J.C.
TCLP: an online cancer cell line catalogue integrating HLA type, predicted neo-epitopes, virus and gene expression.
Genome Med. 7:118.1-118.7(2015)

PubMed=27397505; DOI=10.1016/j.cell.2016.06.017; PMCID=PMC4967469
Iorio F., Knijnenburg T.A., Vis D.J., Bignell G.R., Menden M.P., Schubert M., Aben N., Goncalves E., Barthorpe S., Lightfoot H., Cokelaer T., Greninger P., van Dyk E., Chang H., de Silva H., Heyn H., Deng X.-M., Egan R.K., Liu Q.-S., Mironenko T., Mitropoulos X., Richardson L., Wang J.-H., Zhang T.-H., Moran S., Sayols S., Soleimani M., Tamborero D., Lopez-Bigas N., Ross-Macdonald P., Esteller M., Gray N.S., Haber D.A., Stratton M.R., Benes C.H., Wessels L.F.A., Saez-Rodriguez J., McDermott U., Garnett M.J.
A landscape of pharmacogenomic interactions in cancer.
Cell 166:740-754(2016)

CLPUB00604
Chow S.
Targeted capture and sequencing of immunoglobulin rearrangements in multiple myeloma to enable detection of minimal residual disease.
Thesis MSc (2017); University of Toronto; Toronto; Canada

PubMed=28196595; DOI=10.1016/j.ccell.2017.01.005; PMCID=PMC5501076
Li J., Zhao W., Akbani R., Liu W.-B., Ju Z.-L., Ling S.-Y., Vellano C.P., Roebuck P., Yu Q.-H., Eterovic A.K., Byers L.A., Davies M.A., Deng W.-L., Gopal Y.N.V., Chen G., von Euw E.M., Slamon D.J., Conklin D., Heymach J.V., Gazdar A.F., Minna J.D., Myers J.N., Lu Y.-L., Mills G.B., Liang H.
Characterization of human cancer cell lines by reverse-phase protein arrays.
Cancer Cell 31:225-239(2017)

PubMed=30285677; DOI=10.1186/s12885-018-4840-5; PMCID=PMC6167786
Tan K.-T., Ding L.-W., Sun Q.-Y., Lao Z.-T., Chien W., Ren X., Xiao J.-F., Loh X.-Y., Xu L., Lill M., Mayakonda A., Lin D.-C., Yang H.H., Koeffler H.P.
Profiling the B/T cell receptor repertoire of lymphocyte derived cell lines.
BMC Cancer 18:940.1-940.13(2018)

PubMed=30545397; DOI=10.1186/s13045-018-0679-0; PMCID=PMC6293660
Tessoulin B., Moreau-Aubry A., Descamps G., Gomez-Bougie P., Maiga S., Gaignard A., Chiron D., Menoret E., Le Gouill S., Moreau P., Amiot M., Pellat-Deceunynck C.
Whole-exon sequencing of human myeloma cell lines shows mutations related to myeloma patients at relapse with major hits in the DNA regulation and repair pathways.
J. Hematol. Oncol. 11:137.1-137.13(2018)

PubMed=30894373; DOI=10.1158/0008-5472.CAN-18-2747; PMCID=PMC6445675
Dutil J., Chen Z.-H., Monteiro A.N.A., Teer J.K., Eschrich S.A.
An interactive resource to probe genetic diversity and estimated ancestry in cancer cell lines.
Cancer Res. 79:1263-1273(2019)

PubMed=30971826; DOI=10.1038/s41586-019-1103-9
Behan F.M., Iorio F., Picco G., Goncalves E., Beaver C.M., Migliardi G., Santos R., Rao Y., Sassi F., Pinnelli M., Ansari R., Harper S., Jackson D.A., McRae R., Pooley R., Wilkinson P., van der Meer D.J., Dow D., Buser-Doepner C.A., Bertotti A., Trusolino L., Stronach E.A., Saez-Rodriguez J., Yusa K., Garnett M.J.
Prioritization of cancer therapeutic targets using CRISPR-Cas9 screens.
Nature 568:511-516(2019)

PubMed=31068700; DOI=10.1038/s41586-019-1186-3; PMCID=PMC6697103
Ghandi M., Huang F.W., Jane-Valbuena J., Kryukov G.V., Lo C.C., McDonald E.R. 3rd, Barretina J.G., Gelfand E.T., Bielski C.M., Li H.-X., Hu K., Andreev-Drakhlin A.Y., Kim J., Hess J.M., Haas B.J., Aguet F., Weir B.A., Rothberg M.V., Paolella B.R., Lawrence M.S., Akbani R., Lu Y.-L., Tiv H.L., Gokhale P.C., de Weck A., Mansour A.A., Oh C., Shih J., Hadi K., Rosen Y., Bistline J., Venkatesan K., Reddy A., Sonkin D., Liu M., Lehar J., Korn J.M., Porter D.A., Jones M.D., Golji J., Caponigro G., Taylor J.E., Dunning C.M., Creech A.L., Warren A.C., McFarland J.M., Zamanighomi M., Kauffmann A., Stransky N., Imielinski M., Maruvka Y.E., Cherniack A.D., Tsherniak A., Vazquez F., Jaffe J.D., Lane A.A., Weinstock D.M., Johannessen C.M., Morrissey M.P., Stegmeier F., Schlegel R., Hahn W.C., Getz G., Mills G.B., Boehm J.S., Golub T.R., Garraway L.A., Sellers W.R.
Next-generation characterization of the Cancer Cell Line Encyclopedia.
Nature 569:503-508(2019)

PubMed=32123307; DOI=10.1038/s41375-020-0785-1; PMCID=PMC7483300
Sarin V., Yu K., Ferguson I.D., Gugliemini O., Nix M.A., Hann B., Sirota M., Wiita A.P.
Evaluating the efficacy of multiple myeloma cell lines as models for patient tumors via transcriptomic correlation analysis.
Leukemia 34:2754-2765(2020)

PubMed=35839778; DOI=10.1016/j.ccell.2022.06.010; PMCID=PMC9387775
Goncalves E., Poulos R.C., Cai Z.-X., Barthorpe S., Manda S.S., Lucas N., Beck A., Bucio-Noble D., Dausmann M., Hall C., Hecker M., Koh J., Lightfoot H., Mahboob S., Mali I., Morris J., Richardson L., Seneviratne A.J., Shepherd R., Sykes E., Thomas F., Valentini S., Williams S.G., Wu Y.-X., Xavier D., MacKenzie K.L., Hains P.G., Tully B., Robinson P.J., Zhong Q., Garnett M.J., Reddel R.R.
Pan-cancer proteomic map of 949 human cell lines.
Cancer Cell 40:835-849.e8(2022)

Cross-references
Cell line collections (Providers) ATCC; CRL-2974
CLS; 305304
IZSLER; BS TCL 237
Cell line databases/resources CLO; CLO_0037203
cancercelllines; CVCL_8792
CCRID; 1101HUM-PUMC000680
CCRID; 3101HUMSCSP5017
Cell_Model_Passport; SIDM01265
Cosmic-CLP; 1659818
DepMap; ACH-000763
Lonza; 168
Anatomy/cell type resources BTO; BTO_0003933
Biological sample resources BioSample; SAMN03471684
BioSample; SAMN10988254
ENCODE; ENCBS205VYW
ENCODE; ENCBS241TLI
ENCODE; ENCBS299YQN
ENCODE; ENCBS523NFL
ENCODE; ENCBS981ZAE
CRISP screens repositories BioGRID_ORCS_Cell_line; 801
Chemistry resources ChEMBL-Cells; CHEMBL4295490
ChEMBL-Targets; CHEMBL4296471
GDSC; 1659818
PharmacoDB; MM1S_944_2019
PubChem_Cell_line; CVCL_8792
Encyclopedic resources Wikidata; Q54906038
Experimental variables resources EFO; EFO_0005724
Gene expression databases ArrayExpress; E-MTAB-2706
ArrayExpress; E-MTAB-2770
ArrayExpress; E-MTAB-3610
ArrayExpress; E-TABM-1088
GEO; GSM562814
GEO; GSM887328
GEO; GSM888404
GEO; GSM1374685
GEO; GSM1666388
GEO; GSM1670118
Polymorphism and mutation databases Cosmic; 1424218
Cosmic; 1483077
Cosmic; 1762460
Cosmic; 1889512
Cosmic; 2081430
Cosmic; 2391805
Cosmic; 2809756
IARC_TP53; 28513
LiGeA; CCLE_132
Progenetix; CVCL_8792
Proteomic databases PRIDE; PXD021265
PRIDE; PXD030304
Sequence databases EGA; EGAS00001000610
EGA; EGAS00001000978
Entry history
Entry creation06-Jun-2012
Last entry update10-Apr-2025
Version number38