Cellosaurus logo
expasy logo

Cellosaurus HyCyte MM.1S-Luc-GFP (CVCL_E3I2)

[Text version]
Cell line name HyCyte MM.1S-Luc-GFP
Synonyms Luciferase/GFP Dual-Reporter MM.1S Cell Line
Accession CVCL_E3I2
Resource Identification Initiative To cite this cell line use: HyCyte MM.1S-Luc-GFP (RRID:CVCL_E3I2)
Comments Population: African American.
Characteristics: Produces IgA lambda (from parent cell line).
Doubling time: 24-48 hours (Hysigen=TCH-C260LG).
Genetic integration: Method=PiggyBac transposition; Gene=FPbase; R9NL8; eGFP (Note=Enhanced GFP).
Genetic integration: Method=PiggyBac transposition; Gene=UniProtKB; P08659; Photinus pyralis firefly-type luciferase.
Genetic integration: Method=PiggyBac transposition; Gene=UniProtKB; P13249; Streptomyces alboniger pac (PuroR).
Derived from site: In situ; Peripheral blood; UBERON=UBERON_0000178.
Cell type: Plasma cell; CL=CL_0000786.
Sequence variations
  • Mutation; HGNC; HGNC:6407; KRAS; Simple; p.Gly12Ala (c.35G>C); ClinVar=VCV000045122; Zygosity=Heterozygous (from parent cell line).
  • Mutation; HGNC; HGNC:12033; TRAF3; Simple; p.Val536_Asn545delValPheValAlaGlnThrValLeuGluAsninsAsp (c.1604-1630delTCTTTGTGGCCCAAACTGTTCTAGAAA); Zygosity=Homozygous (from parent cell line).
Disease Plasma cell myeloma (NCIt: C3242)
Multiple myeloma (ORDO: Orphanet_29073)
Species of origin Homo sapiens (Human) (NCBI Taxonomy: 9606)
Hierarchy Parent: CVCL_8792 (MM1.S)
Sex of cell Female
Age at sampling 45Y
Category Cancer cell line
Cross-references
Cell line collections (Providers) Hysigen; TCH-C260LG
Entry history
Entry creation19-Dec-2024
Last entry update14-Aug-2025
Version number2