Cellosaurus logo
expasy logo

Cellosaurus MM.1 (CVCL_5801)

[Text][XML][JSON]
Cell line name MM.1
Synonyms MM-1; MM1
Accession CVCL_5801
Resource Identification Initiative To cite this cell line use: MM.1 (RRID:CVCL_5801)
Comments Part of: MD Anderson Cell Lines Project.
Population: African American.
Characteristics: Produces IgA lambda.
Doubling time: 72 hours (PubMed=12691914).
Omics: Proteomics; Expression; Reverse-phase protein array.
Derived from site: In situ; Peripheral blood; UBERON=UBERON_0000178.
Cell type: Plasma cell; CL=CL_0000786.
Sequence variations
  • Mutation; HGNC; HGNC:6407; KRAS; Simple; p.Gly12Ala (c.35G>C); ClinVar=VCV000045122; Zygosity=Heterozygous (from child cell line MM1.S).
  • Mutation; HGNC; HGNC:12033; TRAF3; Simple; p.Val536_Asn545delValPheValAlaGlnThrValLeuGluAsninsAsp (c.1604-1630delTCTTTGTGGCCCAAACTGTTCTAGAAA); Zygosity=Homozygous (from child cell line MM1.S).
Disease Plasma cell myeloma (NCIt: C3242)
Multiple myeloma (ORDO: Orphanet_29073)
Species of origin Homo sapiens (Human) (NCBI Taxonomy: 9606)
Hierarchy Children:
CVCL_EI97 (MM.1-144)CVCL_8794 (MM1.R)CVCL_8793 (MM1.R(E))
CVCL_8792 (MM1.S)
Sex of cell Female
Age at sampling 45Y
Category Cancer cell line
Web pages Info; MCLP; -; https://tcpaportal.org/mclp/
Publications

PubMed=2926241
Robin E. Goldman-Leikin, Helen R. Salwen, Charles Vincent Herst, Daina Variakojis, Mei-Lu Bian, Michelle M. Le Beau, Peter Selvanayagan, Robert J. Marder, Rhonda Anderson, Sigmund Arthur Weitzman, Steven T. Rosen;
Characterization of a novel myeloma cell line, MM.1.
J. Lab. Clin. Med. 113:335-345(1989)

PubMed=8943038; DOI=10.1073/pnas.93.24.13931; PMCID=PMC19472
Peter Leif Bergsagel, Marta Chesi, Elena Nardini, Leslie A. Brents, Suzanne Lee Kirby, Walter Michael Kuehl;
Promiscuous translocations into immunoglobulin heavy chain switch regions in multiple myeloma.
Proc. Natl. Acad. Sci. U.S.A. 93:13931-13936(1996)

PubMed=10087940; DOI=10.1016/S0165-4608(98)00157-5
Jeroen Kuipers, Jan Willem Vaandrager, Danielle Olde Weghuis, Peter Lees Pearson, Jacques Scheres, Henk Martinus Lokhorst, Hans Cornelius Clevers, Bert J.E.G. Bast;
Fluorescence in situ hybridization analysis shows the frequent occurrence of 14q32.3 rearrangements with involvement of immunoglobulin switch regions in myeloma cell lines.
Cancer Genet. Cytogenet. 109:99-107(1999)

DOI=10.1007/0-306-46877-8_4
Helena Jernberg-Wiklund, Kenneth Nilsson;
Multiple myeloma cell lines.
(In book chapter) Human cell culture. Vol. 3. Cancer cell lines part 3; Masters, John R.W. & Palsson, Bernhard Orn (eds.); pp.81-155; Kluwer Academic Publishers; New York; USA (2000)

PubMed=10936422; DOI=10.1016/S0145-2126(99)00195-2
Hans Gunther Drexler, Yoshinobu Matsuo;
Malignant hematopoietic cell lines: in vitro models for the study of multiple myeloma and plasma cell leukemia.
Leuk. Res. 24:681-703(2000)

DOI=10.1016/B978-0-12-221970-2.50457-5
Hans Gunther Drexler;
The leukemia-lymphoma cell line factsbook.
(In book) ISBN 9780122219702; pp.1-733; Academic Press; London; United Kingdom (2001)

PubMed=12691914; DOI=10.1016/S0301-472X(03)00023-7
Stephanie Greenstein, Nancy L. Krett, Yoshihiro Kurosawa, Chun-Guang Ma, Dharminder Chauhan, Teru Hideshima, Kenneth Carl Anderson, Steven T. Rosen;
Characterization of the MM.1 human multiple myeloma (MM) cell lines: a model system to elucidate the characteristics, behavior, and signaling of steroid-sensitive and -resistant MM cells.
Exp. Hematol. 31:271-282(2003)

PubMed=28196595; DOI=10.1016/j.ccell.2017.01.005; PMCID=PMC5501076
Jun Li, Wei Zhao, Rehan Akbani, Wen-Bin Liu, Zhen-Lin Ju, Shi-Yun Ling, Christopher P. Vellano, Paul Roebuck, Qing-Hua Yu, Agda Karina Eterovic, Lauren Averett Byers ...Show all 25 authors... , Michael A. Davies, Wan-Leng Deng, Y.N. Vashisht Gopal, Guo Chen, Erika Maria von Euw, Dennis Joseph Slamon, Dylan Conklin, John Victor Heymach, Adi F. Gazdar, John D. Minna, Jeffrey N. Myers, Yi-Ling Lu, Gordon B. Mills, Han Liang; Show fewer authors
Characterization of human cancer cell lines by reverse-phase protein arrays.
Cancer Cell 31:225-239(2017)

Cross-references
Cell line databases/resources cancercelllines; CVCL_5801
Cell_Model_Passport; SIDM00624
Anatomy/cell type resources BTO; BTO_0005490
Encyclopedic resources Wikidata; Q54906030
Experimental variables resources EFO; EFO_0001219
Polymorphism and mutation databases Cosmic; 2302411
Cosmic; 2367262
Entry history
Entry creation04-Apr-2012
Last entry update14-Aug-2025
Version number27