Cellosaurus logo
expasy logo

Cellosaurus BPS Bioscience MM.1S TNFRSF17 KO (CVCL_E8DM)

[Text][XML][JSON]
Cell line name BPS Bioscience MM.1S TNFRSF17 KO
Synonyms BCMA knockout MM.1S
Accession CVCL_E8DM
Resource Identification Initiative To cite this cell line use: BPS Bioscience MM.1S TNFRSF17 KO (RRID:CVCL_E8DM)
Comments Population: African American.
Characteristics: Produces IgA lambda (from parent cell line).
Knockout cell: Method=CRISPR/Cas9; HGNC; HGNC:11913; TNFRSF17.
Derived from site: In situ; Peripheral blood; UBERON=UBERON_0000178.
Cell type: Plasma cell; CL=CL_0000786.
Sequence variations
  • Mutation; HGNC; HGNC:6407; KRAS; Simple; p.Gly12Ala (c.35G>C); ClinVar=VCV000045122; Zygosity=Heterozygous (from parent cell line).
  • Mutation; HGNC; HGNC:12033; TRAF3; Simple; p.Val536_Asn545delValPheValAlaGlnThrValLeuGluAsninsAsp (c.1604-1630delTCTTTGTGGCCCAAACTGTTCTAGAAA); Zygosity=Homozygous (from parent cell line).
Disease Plasma cell myeloma (NCIt: C3242)
Multiple myeloma (ORDO: Orphanet_29073)
Species of origin Homo sapiens (Human) (NCBI Taxonomy: 9606)
Hierarchy Parent: CVCL_8792 (MM1.S)
Sex of cell Female
Age at sampling 45Y
Category Cancer cell line
Web pages Provider; BPS Bioscience; 82687; https://bpsbioscience.com/bcma-knockout-mm-1s-cell-line-82687
Entry history
Entry creation10-Apr-2025
Last entry update14-Aug-2025
Version number2