ID   MM1.S
AC   CVCL_8792
SY   MM.1S; MM1-S; MM-1S; MM1S
DR   BTO; BTO_0003933
DR   CLO; CLO_0037203
DR   EFO; EFO_0005724
DR   ArrayExpress; E-MTAB-2706
DR   ArrayExpress; E-MTAB-2770
DR   ArrayExpress; E-MTAB-3610
DR   ArrayExpress; E-TABM-1088
DR   ATCC; CRL-2974
DR   BioGRID_ORCS_Cell_line; 801
DR   BioSample; SAMN03471684
DR   BioSample; SAMN10988254
DR   cancercelllines; CVCL_8792
DR   CCRID; 1101HUM-PUMC000680
DR   CCRID; 3101HUMSCSP5017
DR   Cell_Model_Passport; SIDM01265
DR   ChEMBL-Cells; CHEMBL4295490
DR   ChEMBL-Targets; CHEMBL4296471
DR   CLS; 305304
DR   Cosmic; 1424218
DR   Cosmic; 1483077
DR   Cosmic; 1762460
DR   Cosmic; 1889512
DR   Cosmic; 2081430
DR   Cosmic; 2391805
DR   Cosmic; 2809756
DR   Cosmic-CLP; 1659818
DR   DepMap; ACH-000763
DR   EGA; EGAS00001000610
DR   EGA; EGAS00001000978
DR   ENCODE; ENCBS205VYW
DR   ENCODE; ENCBS241TLI
DR   ENCODE; ENCBS299YQN
DR   ENCODE; ENCBS523NFL
DR   ENCODE; ENCBS981ZAE
DR   GDSC; 1659818
DR   GEO; GSM562814
DR   GEO; GSM887328
DR   GEO; GSM888404
DR   GEO; GSM1374685
DR   GEO; GSM1666388
DR   GEO; GSM1670118
DR   IARC_TP53; 28513
DR   IZSLER; BS TCL 237
DR   LiGeA; CCLE_132
DR   Lonza; 168
DR   PharmacoDB; MM1S_944_2019
DR   PRIDE; PXD021265
DR   PRIDE; PXD030304
DR   Progenetix; CVCL_8792
DR   PubChem_Cell_line; CVCL_8792
DR   Wikidata; Q54906038
RX   CelloPub=CLPUB00604;
RX   PubMed=12691914;
RX   PubMed=14760100;
RX   PubMed=16956823;
RX   PubMed=17692805;
RX   PubMed=18647998;
RX   PubMed=21173094;
RX   PubMed=22460905;
RX   PubMed=25485619;
RX   PubMed=25688540;
RX   PubMed=25877200;
RX   PubMed=25984343;
RX   PubMed=26589293;
RX   PubMed=27397505;
RX   PubMed=28196595;
RX   PubMed=30285677;
RX   PubMed=30545397;
RX   PubMed=30894373;
RX   PubMed=30971826;
RX   PubMed=31068700;
RX   PubMed=32123307;
RX   PubMed=35839778;
WW   Info; ATCC; -; https://www.atcc.org/en/support/technical-support/faqs/morphology-of-item-mm-1s-atcc-crl-2974
WW   Info; Keats Lab; -; https://www.keatslab.org/myeloma-cell-lines
WW   Info; MCLP; -; https://tcpaportal.org/mclp/
CC   Part of: Cancer Dependency Map project (DepMap) (includes Cancer Cell Line Encyclopedia - CCLE).
CC   Part of: COSMIC cell lines project.
CC   Part of: MD Anderson Cell Lines Project.
CC   Population: African American.
CC   Characteristics: Produces IgA lambda (ATCC=CRL-2974).
CC   Characteristics: Sensitive to dexamethasone.
CC   Doubling time: 80 hours (PubMed=25984343); ~72 hours (ATCC=CRL-2974).
CC   HLA typing: A*23,24; B*18,42; C*12,17 (PubMed=25688540).
CC   HLA typing: A*23:01,24:02; B*18:01,42:01; C*12:03,17:01 (PubMed=26589293).
CC   Microsatellite instability: Instable (MSI-low) (Sanger).
CC   Sequence variation: Mutation; HGNC; HGNC:6407; KRAS; Simple; p.Gly12Ala (c.35G>C); ClinVar=VCV000045122; Zygosity=Heterozygous (PubMed=21173094; Cosmic-CLP=1659818; DepMap=ACH-000763).
CC   Sequence variation: Mutation; HGNC; HGNC:12033; TRAF3; Simple; p.Val536_Asn545delValPheValAlaGlnThrValLeuGluAsninsAsp (c.1604-1630delTCTTTGTGGCCCAAACTGTTCTAGAAA); Zygosity=Homozygous (PubMed=17692805).
CC   Omics: Genomics; DNA methylation analysis.
CC   Omics: Genomics; Whole exome sequencing.
CC   Omics: Phenotyping; CRISPR screening.
CC   Omics: Phenotyping; Drug screening.
CC   Omics: Phenotyping; shRNA library screening.
CC   Omics: Proteomics; Expression; Reverse-phase protein array.
CC   Omics: Proteomics; Quantitative.
CC   Omics: Transcriptomics; Microarray.
CC   Omics: Transcriptomics; RNAseq.
CC   Omics: Variations; Array-based CGH.
CC   Omics: Variations; SNP array analysis.
CC   Genome ancestry: African=88.68%; Native American=0%; East Asian, North=4.01%; East Asian, South=0%; South Asian=0.43%; European, North=0%; European, South=6.87% (PubMed=30894373).
CC   Derived from site: In situ; Peripheral blood; UBERON=UBERON_0000178.
CC   Cell type: B-cell; CL=CL_0000236.
ST   Source(s): ATCC=CRL-2974; Cosmic-CLP=1659818; PubMed=25877200; Technion Genomics Center
ST   Amelogenin: X
ST   CSF1PO: 9,14
ST   D10S1248: 12,15
ST   D12S391: 17,24
ST   D13S317: 13
ST   D16S539: 12
ST   D18S51: 11,16
ST   D19S433: 13
ST   D1S1656: 11,12
ST   D21S11: 29,30
ST   D22S1045: 10,11
ST   D2S1338: 21,22
ST   D2S441: 11
ST   D3S1358: 16,17
ST   D5S818: 8,12
ST   D7S820: 10,11
ST   D8S1179: 14
ST   FGA: 20,24
ST   Penta D: 2.2,9
ST   Penta E: 13,15
ST   TH01: 7,8
ST   TPOX: 8
ST   vWA: 15,17
DI   NCIt; C3242; Plasma cell myeloma
DI   ORDO; Orphanet_29073; Multiple myeloma
OX   NCBI_TaxID=9606; ! Homo sapiens (Human)
HI   CVCL_5801 ! MM.1
SX   Female
AG   45Y
CA   Cancer cell line
DT   Created: 06-06-12; Last updated: 10-04-25; Version: 38
//
RX   CelloPub=CLPUB00604;
RA   Chow S.;
RT   "Targeted capture and sequencing of immunoglobulin rearrangements
RT   in multiple myeloma to enable detection of minimal residual disease.";
RL   Thesis MSc (2017); University of Toronto; Toronto; Canada.
//
RX   PubMed=12691914; DOI=10.1016/S0301-472X(03)00023-7;
RA   Greenstein S., Krett N.L., Kurosawa Y., Ma C.-G., Chauhan D.,
RA   Hideshima T., Anderson K.C., Rosen S.T.;
RT   "Characterization of the MM.1 human multiple myeloma (MM) cell lines:
RT   a model system to elucidate the characteristics, behavior, and
RT   signaling of steroid-sensitive and -resistant MM cells.";
RL   Exp. Hematol. 31:271-282(2003).
//
RX   PubMed=14760100; DOI=10.1158/1078-0432.CCR-0793-03;
RA   Shammas M.A., Shmookler Reis R.J., Li C., Koley H., Hurley L.H.,
RA   Anderson K.C., Munshi N.C.;
RT   "Telomerase inhibition and cell growth arrest after telomestatin
RT   treatment in multiple myeloma.";
RL   Clin. Cancer Res. 10:770-776(2004).
//
RX   PubMed=16956823;
RA   Bataille F.-R., Jego G., Robillard N., Barille-Nion S., Harousseau J.-L.,
RA   Moreau P., Amiot M., Pellat-Deceunynck C.;
RT   "The phenotype of normal, reactive and malignant plasma cells.
RT   Identification of 'many and multiple myelomas' and of new targets for
RT   myeloma therapy.";
RL   Haematologica 91:1234-1240(2006).
//
RX   PubMed=17692805; DOI=10.1016/j.ccr.2007.07.003; PMCID=PMC2083698;
RA   Keats J.J., Fonseca R., Chesi M., Schop R., Baker A., Chng W.-J.,
RA   Van Wier S., Tiedemann R., Shi C.-X., Sebag M., Braggio E., Henry T.,
RA   Zhu Y.-X., Fogle H., Price-Troska T.L., Ahmann G.J., Mancini C.,
RA   Brents L.A., Kumar S.K., Greipp P.R., Dispenzieri A., Bryant B.,
RA   Mulligan G., Bruhn L., Barrett M.T., Valdez R., Trent J.M.,
RA   Stewart A.K., Carpten J.D., Bergsagel P.L.;
RT   "Promiscuous mutations activate the noncanonical NF-kappaB pathway in
RT   multiple myeloma.";
RL   Cancer Cell 12:131-144(2007).
//
RX   PubMed=18647998; DOI=10.1093/jncimonographs/lgn011; PMCID=PMC2737184;
RA   Dib A., Gabrea A., Glebov O.K., Bergsagel P.L., Kuehl W.M.;
RT   "Characterization of MYC translocations in multiple myeloma cell
RT   lines.";
RL   J. Natl. Cancer Inst. Monogr. 39:25-31(2008).
//
RX   PubMed=21173094; DOI=10.3324/haematol.2010.033456; PMCID=PMC3069235;
RA   Moreaux J., Klein B., Bataille F.-R., Descamps G., Maiga S., Hose D.,
RA   Goldschmidt H., Jauch A., Reme T., Jourdan M., Amiot M.,
RA   Pellat-Deceunynck C.;
RT   "A high-risk signature for patients with multiple myeloma established
RT   from the molecular classification of human myeloma cell lines.";
RL   Haematologica 96:574-582(2011).
//
RX   PubMed=22460905; DOI=10.1038/nature11003; PMCID=PMC3320027;
RA   Barretina J.G., Caponigro G., Stransky N., Venkatesan K., Margolin A.A.,
RA   Kim S., Wilson C.J., Lehar J., Kryukov G.V., Sonkin D., Reddy A.,
RA   Liu M., Murray L., Berger M.F., Monahan J.E., Morais P., Meltzer J.,
RA   Korejwa A., Jane-Valbuena J., Mapa F.A., Thibault J., Bric-Furlong E.,
RA   Raman P., Shipway A., Engels I.H., Cheng J., Yu G.-Y.K., Yu J.-J.,
RA   Aspesi P. Jr., de Silva M., Jagtap K., Jones M.D., Wang L., Hatton C.,
RA   Palescandolo E., Gupta S., Mahan S., Sougnez C., Onofrio R.C.,
RA   Liefeld T., MacConaill L.E., Winckler W., Reich M., Li N.-X., Mesirov J.P.,
RA   Gabriel S.B., Getz G., Ardlie K., Chan V., Myer V.E., Weber B.L.,
RA   Porter J., Warmuth M., Finan P., Harris J.L., Meyerson M.L., Golub T.R.,
RA   Morrissey M.P., Sellers W.R., Schlegel R., Garraway L.A.;
RT   "The Cancer Cell Line Encyclopedia enables predictive modelling of
RT   anticancer drug sensitivity.";
RL   Nature 483:603-607(2012).
//
RX   PubMed=25485619; DOI=10.1038/nbt.3080;
RA   Klijn C., Durinck S., Stawiski E.W., Haverty P.M., Jiang Z.-S.,
RA   Liu H.-B., Degenhardt J., Mayba O., Gnad F., Liu J.-F., Pau G.,
RA   Reeder J., Cao Y., Mukhyala K., Selvaraj S.K., Yu M.-M., Zynda G.J.,
RA   Brauer M.J., Wu T.D., Gentleman R.C., Manning G., Yauch R.L.,
RA   Bourgon R., Stokoe D., Modrusan Z., Neve R.M., de Sauvage F.J.,
RA   Settleman J., Seshagiri S., Zhang Z.-M.;
RT   "A comprehensive transcriptional portrait of human cancer cell
RT   lines.";
RL   Nat. Biotechnol. 33:306-312(2015).
//
RX   PubMed=25688540; DOI=10.1002/cyto.a.22643;
RA   Maiga S., Brosseau C., Descamps G., Dousset C., Gomez-Bougie P.,
RA   Chiron D., Menoret E., Kervoelen C., Vie H., Cesbron A.,
RA   Moreau-Aubry A., Amiot M., Pellat-Deceunynck C.;
RT   "A simple flow cytometry-based barcode for routine authentication of
RT   multiple myeloma and mantle cell lymphoma cell lines.";
RL   Cytometry A 87:285-288(2015).
//
RX   PubMed=25877200; DOI=10.1038/nature14397;
RA   Yu M., Selvaraj S.K., Liang-Chu M.M.Y., Aghajani S., Busse M.,
RA   Yuan J., Lee G., Peale F.V., Klijn C., Bourgon R., Kaminker J.S.,
RA   Neve R.M.;
RT   "A resource for cell line authentication, annotation and quality
RT   control.";
RL   Nature 520:307-311(2015).
//
RX   PubMed=25984343; DOI=10.1038/sdata.2014.35; PMCID=PMC4432652;
RA   Cowley G.S., Weir B.A., Vazquez F., Tamayo P., Scott J.A., Rusin S.,
RA   East-Seletsky A., Ali L.D., Gerath W.F.J., Pantel S.E., Lizotte P.H.,
RA   Jiang G.-Z., Hsiao J., Tsherniak A., Dwinell E., Aoyama S., Okamoto M.,
RA   Harrington W., Gelfand E.T., Green T.M., Tomko M.J., Gopal S.,
RA   Wong T.C., Li H.-B., Howell S., Stransky N., Liefeld T., Jang D.,
RA   Bistline J., Meyers B.H., Armstrong S.A., Anderson K.C.,
RA   Stegmaier K., Reich M., Pellman D., Boehm J.S., Mesirov J.P.,
RA   Golub T.R., Root D.E., Hahn W.C.;
RT   "Parallel genome-scale loss of function screens in 216 cancer cell
RT   lines for the identification of context-specific genetic
RT   dependencies.";
RL   Sci. Data 1:140035.1-140035.12(2014).
//
RX   PubMed=26589293; DOI=10.1186/s13073-015-0240-5; PMCID=PMC4653878;
RA   Scholtalbers J., Boegel S., Bukur T., Byl M., Goerges S., Sorn P.,
RA   Loewer M., Sahin U., Castle J.C.;
RT   "TCLP: an online cancer cell line catalogue integrating HLA type,
RT   predicted neo-epitopes, virus and gene expression.";
RL   Genome Med. 7:118.1-118.7(2015).
//
RX   PubMed=27397505; DOI=10.1016/j.cell.2016.06.017; PMCID=PMC4967469;
RA   Iorio F., Knijnenburg T.A., Vis D.J., Bignell G.R., Menden M.P.,
RA   Schubert M., Aben N., Goncalves E., Barthorpe S., Lightfoot H.,
RA   Cokelaer T., Greninger P., van Dyk E., Chang H., de Silva H., Heyn H.,
RA   Deng X.-M., Egan R.K., Liu Q.-S., Mironenko T., Mitropoulos X.,
RA   Richardson L., Wang J.-H., Zhang T.-H., Moran S., Sayols S.,
RA   Soleimani M., Tamborero D., Lopez-Bigas N., Ross-Macdonald P.,
RA   Esteller M., Gray N.S., Haber D.A., Stratton M.R., Benes C.H.,
RA   Wessels L.F.A., Saez-Rodriguez J., McDermott U., Garnett M.J.;
RT   "A landscape of pharmacogenomic interactions in cancer.";
RL   Cell 166:740-754(2016).
//
RX   PubMed=28196595; DOI=10.1016/j.ccell.2017.01.005; PMCID=PMC5501076;
RA   Li J., Zhao W., Akbani R., Liu W.-B., Ju Z.-L., Ling S.-Y., Vellano C.P.,
RA   Roebuck P., Yu Q.-H., Eterovic A.K., Byers L.A., Davies M.A., Deng W.-L.,
RA   Gopal Y.N.V., Chen G., von Euw E.M., Slamon D.J., Conklin D.,
RA   Heymach J.V., Gazdar A.F., Minna J.D., Myers J.N., Lu Y.-L., Mills G.B.,
RA   Liang H.;
RT   "Characterization of human cancer cell lines by reverse-phase protein
RT   arrays.";
RL   Cancer Cell 31:225-239(2017).
//
RX   PubMed=30285677; DOI=10.1186/s12885-018-4840-5; PMCID=PMC6167786;
RA   Tan K.-T., Ding L.-W., Sun Q.-Y., Lao Z.-T., Chien W., Ren X.,
RA   Xiao J.-F., Loh X.-Y., Xu L., Lill M., Mayakonda A., Lin D.-C.,
RA   Yang H.H., Koeffler H.P.;
RT   "Profiling the B/T cell receptor repertoire of lymphocyte derived cell
RT   lines.";
RL   BMC Cancer 18:940.1-940.13(2018).
//
RX   PubMed=30545397; DOI=10.1186/s13045-018-0679-0; PMCID=PMC6293660;
RA   Tessoulin B., Moreau-Aubry A., Descamps G., Gomez-Bougie P., Maiga S.,
RA   Gaignard A., Chiron D., Menoret E., Le Gouill S., Moreau P., Amiot M.,
RA   Pellat-Deceunynck C.;
RT   "Whole-exon sequencing of human myeloma cell lines shows mutations
RT   related to myeloma patients at relapse with major hits in the DNA
RT   regulation and repair pathways.";
RL   J. Hematol. Oncol. 11:137.1-137.13(2018).
//
RX   PubMed=30894373; DOI=10.1158/0008-5472.CAN-18-2747; PMCID=PMC6445675;
RA   Dutil J., Chen Z.-H., Monteiro A.N.A., Teer J.K., Eschrich S.A.;
RT   "An interactive resource to probe genetic diversity and estimated
RT   ancestry in cancer cell lines.";
RL   Cancer Res. 79:1263-1273(2019).
//
RX   PubMed=30971826; DOI=10.1038/s41586-019-1103-9;
RA   Behan F.M., Iorio F., Picco G., Goncalves E., Beaver C.M.,
RA   Migliardi G., Santos R., Rao Y., Sassi F., Pinnelli M., Ansari R.,
RA   Harper S., Jackson D.A., McRae R., Pooley R., Wilkinson P.,
RA   van der Meer D.J., Dow D., Buser-Doepner C.A., Bertotti A., Trusolino L.,
RA   Stronach E.A., Saez-Rodriguez J., Yusa K., Garnett M.J.;
RT   "Prioritization of cancer therapeutic targets using CRISPR-Cas9
RT   screens.";
RL   Nature 568:511-516(2019).
//
RX   PubMed=31068700; DOI=10.1038/s41586-019-1186-3; PMCID=PMC6697103;
RA   Ghandi M., Huang F.W., Jane-Valbuena J., Kryukov G.V., Lo C.C.,
RA   McDonald E.R. 3rd, Barretina J.G., Gelfand E.T., Bielski C.M., Li H.-X.,
RA   Hu K., Andreev-Drakhlin A.Y., Kim J., Hess J.M., Haas B.J., Aguet F.,
RA   Weir B.A., Rothberg M.V., Paolella B.R., Lawrence M.S., Akbani R.,
RA   Lu Y.-L., Tiv H.L., Gokhale P.C., de Weck A., Mansour A.A., Oh C.,
RA   Shih J., Hadi K., Rosen Y., Bistline J., Venkatesan K., Reddy A.,
RA   Sonkin D., Liu M., Lehar J., Korn J.M., Porter D.A., Jones M.D.,
RA   Golji J., Caponigro G., Taylor J.E., Dunning C.M., Creech A.L.,
RA   Warren A.C., McFarland J.M., Zamanighomi M., Kauffmann A.,
RA   Stransky N., Imielinski M., Maruvka Y.E., Cherniack A.D.,
RA   Tsherniak A., Vazquez F., Jaffe J.D., Lane A.A., Weinstock D.M.,
RA   Johannessen C.M., Morrissey M.P., Stegmeier F., Schlegel R.,
RA   Hahn W.C., Getz G., Mills G.B., Boehm J.S., Golub T.R., Garraway L.A.,
RA   Sellers W.R.;
RT   "Next-generation characterization of the Cancer Cell Line
RT   Encyclopedia.";
RL   Nature 569:503-508(2019).
//
RX   PubMed=32123307; DOI=10.1038/s41375-020-0785-1; PMCID=PMC7483300;
RA   Sarin V., Yu K., Ferguson I.D., Gugliemini O., Nix M.A., Hann B.,
RA   Sirota M., Wiita A.P.;
RT   "Evaluating the efficacy of multiple myeloma cell lines as models for
RT   patient tumors via transcriptomic correlation analysis.";
RL   Leukemia 34:2754-2765(2020).
//
RX   PubMed=35839778; DOI=10.1016/j.ccell.2022.06.010; PMCID=PMC9387775;
RA   Goncalves E., Poulos R.C., Cai Z.-X., Barthorpe S., Manda S.S., Lucas N.,
RA   Beck A., Bucio-Noble D., Dausmann M., Hall C., Hecker M., Koh J.,
RA   Lightfoot H., Mahboob S., Mali I., Morris J., Richardson L.,
RA   Seneviratne A.J., Shepherd R., Sykes E., Thomas F., Valentini S.,
RA   Williams S.G., Wu Y.-X., Xavier D., MacKenzie K.L., Hains P.G., Tully B.,
RA   Robinson P.J., Zhong Q., Garnett M.J., Reddel R.R.;
RT   "Pan-cancer proteomic map of 949 human cell lines.";
RL   Cancer Cell 40:835-849.e8(2022).
//