Cellosaurus logo
expasy logo

Cellosaurus MM.1S-luc (CVCL_B7F7)

[Text][XML][JSON]
Cell line name MM.1S-luc
Accession CVCL_B7F7
Resource Identification Initiative To cite this cell line use: MM.1S-luc (RRID:CVCL_B7F7)
Comments Population: African American.
Characteristics: Produces IgA lambda (from parent cell line).
Genetic integration: Method=Transfection/transduction; Gene=UniProtKB; P08659; Photinus pyralis firefly-type luciferase (Note=With optimized codon usage for mammalian expression = effLuc).
Derived from site: In situ; Peripheral blood; UBERON=UBERON_0000178.
Cell type: Plasma cell; CL=CL_0000786.
Sequence variations
  • Mutation; HGNC; HGNC:6407; KRAS; Simple; p.Gly12Ala (c.35G>C); ClinVar=VCV000045122; Zygosity=Heterozygous (from parent cell line).
  • Mutation; HGNC; HGNC:12033; TRAF3; Simple; p.Val536_Asn545delValPheValAlaGlnThrValLeuGluAsninsAsp (c.1604-1630delTCTTTGTGGCCCAAACTGTTCTAGAAA); Zygosity=Homozygous (from parent cell line).
Disease Plasma cell myeloma (NCIt: C3242)
Multiple myeloma (ORDO: Orphanet_29073)
Species of origin Homo sapiens (Human) (NCBI Taxonomy: 9606)
Hierarchy Parent: CVCL_8792 (MM1.S)
Sex of cell Female
Age at sampling 45Y
Category Cancer cell line
Publications

PubMed=32123307; DOI=10.1038/s41375-020-0785-1; PMCID=PMC7483300
Vishesh Sarin, Katharine Yu, Ian D. Ferguson, Olivia Gugliemini, Matthew A. Nix, Byron Hann, Marina Sirota, Arun P. Wiita;
Evaluating the efficacy of multiple myeloma cell lines as models for patient tumors via transcriptomic correlation analysis.
Leukemia 34:2754-2765(2020)

Cross-references
Cell line databases/resources cancercelllines; CVCL_B7F7
Encyclopedic resources Wikidata; Q112930119
Entry history
Entry creation23-Jun-2022
Last entry update14-Aug-2025
Version number8