Cellosaurus logo
expasy logo

Cellosaurus GM16535 (CVCL_DB92)

[Text version]
Cell line name GM16535
Accession CVCL_DB92
Resource Identification Initiative To cite this cell line use: GM16535 (RRID:CVCL_DB92)
Comments Transformant: NCBI_TaxID; 10376; Epstein-Barr virus (EBV).
Donor information: At sampling donor was not affected with cutaneous malignant melanoma 2 but at risk for disease (mutation in CDKN2A start site).
Derived from site: In situ; Peripheral blood; UBERON=UBERON_0000178.
Sequence variations
  • Mutation; HGNC; HGNC:1787; CDKN2A; Simple; p.Pro11_Ser12insAlaAlaGlySerSerMetGluPro (c.9_32dupGGCGGCGGGGAGCAGCATGGAGCC); Zygosity=Unspecified (Coriell=GM16535).
Disease Hereditary melanoma with CDKN2A mutation (NCIt: C128801)
Familial melanoma (ORDO: Orphanet_618)
Species of origin Homo sapiens (Human) (NCBI Taxonomy: 9606)
Sex of cell Female
Age at sampling 29Y
Category Transformed cell line
Cross-references
Cell line collections (Providers) Coriell; GM16535
Cell line databases/resources CLO; CLO_0017579
Encyclopedic resources Wikidata; Q54848630
Entry history
Entry creation13-Jul-2016
Last entry update10-Apr-2025
Version number14