ID   GM16535
AC   CVCL_DB92
DR   CLO; CLO_0017579
DR   Coriell; GM16535
DR   Wikidata; Q54848630
CC   Sequence variation: Mutation; HGNC; HGNC:1787; CDKN2A; Simple; p.Pro11_Ser12insAlaAlaGlySerSerMetGluPro (c.9_32dupGGCGGCGGGGAGCAGCATGGAGCC); Zygosity=Unspecified (Coriell=GM16535).
CC   Transformant: NCBI_TaxID; 10376; Epstein-Barr virus (EBV).
CC   Donor information: At sampling donor was not affected with cutaneous malignant melanoma 2 but at risk for disease (mutation in CDKN2A start site).
CC   Derived from site: In situ; Peripheral blood; UBERON=UBERON_0000178.
DI   NCIt; C128801; Hereditary melanoma with CDKN2A mutation
DI   ORDO; Orphanet_618; Familial melanoma
OX   NCBI_TaxID=9606; ! Homo sapiens (Human)
SX   Female
AG   29Y
CA   Transformed cell line
DT   Created: 13-07-16; Last updated: 10-04-25; Version: 14
//