Cellosaurus logo
expasy logo

Cellosaurus SNU-761 (CVCL_5089)

[Text][XML][JSON]
Cell line name SNU-761
Synonyms SNU761; NCI-SNU-761
Accession CVCL_5089
Resource Identification Initiative To cite this cell line use: SNU-761 (RRID:CVCL_5089)
Comments Part of: Cancer Dependency Map project (DepMap) (includes Cancer Cell Line Encyclopedia - CCLE).
Part of: Liver Cancer Model Repository (LIMORE).
Part of: Seoul National University (SNU) cell line collection.
Population: Korean.
Doubling time: 24 hours (PubMed=11819450); 24.32 hours (PubMed=31378681).
Transformant: NCBI_TaxID; 10407; Hepatitis B virus (HBV).
Omics: Genomics; Whole exome sequencing.
Omics: Genomics; Whole genome sequencing.
Omics: Proteomics; Expression; Reverse-phase protein array.
Omics: Transcriptomics; Microarray.
Omics: Transcriptomics; miRNA profiling; Microarray.
Omics: Transcriptomics; RNAseq.
Omics: Variations; SNP array analysis.
Derived from site: In situ; Liver; UBERON=UBERON_0002107.
Sequence variations
  • Mutation; HGNC; HGNC:11998; TP53; Simple; p.Ser313Glyfs*13 (c.937_968delAGCTCCTCTCCCCAGCCAAAGAAGAAACCACT); Zygosity=Unspecified (PubMed=8824565; PubMed=31378681).
HLA typing Source: PubMed=26589293
Class I
HLA-AA*11:01,11:01
HLA-BB*13:01,13:01
HLA-CC*03:04,03:04
Genome ancestry Source: PubMed=30894373

Origin% genome
African0.61
Native American0
East Asian, North59.84
East Asian, South38.16
South Asian0
European, North0
European, South1.38
Disease Adult hepatocellular carcinoma (NCIt: C7956)
Adult hepatocellular carcinoma (ORDO: Orphanet_210159)
Species of origin Homo sapiens (Human) (NCBI Taxonomy: 9606)
Sex of cell Male
Age at sampling 49Y
Category Cancer cell line
STR profile Source(s): KCLB=00761; PubMed=31378681

Markers:
AmelogeninX,Y
CSF1PO12
D3S135815,17
D5S8189,12
D7S8209
D13S31710
D16S53911
FGA23,24
TH019
TPOX11
vWA16

Run an STR similarity search on this cell line
Web pages Info; LCCL; -; https://lccl.zucmanlab.com/hcc/cellLines/SNU761
Publications

PubMed=8824565; DOI=10.1002/(SICI)1097-0215(19960917)67:6<898::AID-IJC22>3.0.CO;2-X
Myung-Soo Kang, Hong-Joo Lee, Jae-Ho Lee, Ja-Lok Ku, Kathreen P. Lee, Michael J. Kelley, Yong-Jin Won, Soo-Tae Kim, Jae-Gahb Park;
Mutation of p53 gene in hepatocellular carcinoma cell lines with HBX DNA.
Int. J. Cancer 67:898-902(1996)

PubMed=11819450; DOI=10.3748/wjg.v5.i4.289; PMCID=PMC4695537
Jae-Ho Lee, Ja-Lok Ku, Young-Jin Park, Kuhn-Uk Lee, Woo-Ho Kim, Jae-Gahb Park;
Establishment and characterization of four human hepatocellular carcinoma cell lines containing hepatitis B virus DNA.
World J. Gastroenterol. 5:289-295(1999)

PubMed=19956504; DOI=10.4143/crt.2005.37.1.1; PMCID=PMC2785416
Ja-Lok Ku, Jae-Gahb Park;
Biology of SNU cell lines.
Cancer Res. Treat. 37:1-19(2005)

PubMed=22460905; DOI=10.1038/nature11003; PMCID=PMC3320027
Jordi Ginesta Barretina, Giordano Caponigro, Nicolas Stransky, Kavitha Venkatesan, Adam A. Margolin, Sungjoon Kim, Christopher J. Wilson, Joseph Lehar, Gregory V. Kryukov, Dmitriy Sonkin, Anupama Reddy ...Show all 61 authors... , Manway Liu, Lauren Murray, Michael F. Berger, John E. Monahan, Paula Morais, Jodi Meltzer, Adam Korejwa, Judit Jane-Valbuena, Felipa A. Mapa, Joseph Thibault, Eva Bric-Furlong, Pichai Raman, Aaron Shipway, Ingo H. Engels, Jill Cheng, Guo-Ying K. Yu, Jian-Jun Yu, Peter Aspesi Jr., Melanie de Silva, Kalpana Jagtap, Michael D. Jones, Li Wang, Charles Hatton, Emanuele Palescandolo, Supriya Gupta, Scott Mahan, Carrie Sougnez, Robert C. Onofrio, Ted Liefeld, Laura Eleanor MacConaill, Wendy Winckler, Michael Reich, Nan-Xin Li, Jill P. Mesirov, Stacey B. Gabriel, Gad Getz, Kristin Ardlie, Vivien Chan, Vic E. Myer, Barbara L. Weber, Jeff Porter, Markus Warmuth, Peter Finan, Jennifer L. Harris, Matthew Langer Meyerson, Todd Robert Golub, Michael P. Morrissey, William Raj Sellers, Robert Schlegel, Levi Alexander Garraway; Show fewer authors
The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug sensitivity.
Nature 483:603-607(2012)

PubMed=26589293; DOI=10.1186/s13073-015-0240-5; PMCID=PMC4653878
Jelle Scholtalbers, Sebastian Boegel, Thomas Bukur, Marius Byl, Sebastian Goerges, Patrick Sorn, Martin Loewer, Ugur Sahin, John C. Castle;
TCLP: an online cancer cell line catalogue integrating HLA type, predicted neo-epitopes, virus and gene expression.
Genome Med. 7:118.1-118.7(2015)

PubMed=30894373; DOI=10.1158/0008-5472.CAN-18-2747; PMCID=PMC6445675
Julie Dutil, Zhi-Hua Chen, Alvaro N.A. Monteiro, Jamie K. Teer, Steven A. Eschrich;
An interactive resource to probe genetic diversity and estimated ancestry in cancer cell lines.
Cancer Res. 79:1263-1273(2019)

PubMed=31063779; DOI=10.1053/j.gastro.2019.05.001
Stefano Caruso, Anna-Line Calatayud, Jill Pilet, Tiziana La Bella, Samia Rekik, Sandrine Imbeaud, Eric Letouze, Lea Meunier, Quentin Bayard, Nataliya Rohr-Udilova, Camille Peneau ...Show all 20 authors... , Bettina Grasl-Kraupp, Leanne de Koning, Berengere Ouine, Paulette Bioulac-Sage, Gabrielle Couchy, Julien Calderaro, Jean-Charles Nault, Jessica Zucman-Rossi, Sandra Rebouissou; Show fewer authors
Analysis of liver cancer cell lines identifies agents with likely efficacy against hepatocellular carcinoma and markers of response.
Gastroenterology 157:760-776(2019)

PubMed=31068700; DOI=10.1038/s41586-019-1186-3; PMCID=PMC6697103
Mahmoud Ghandi, Franklin W. Huang, Judit Jane-Valbuena, Gregory V. Kryukov, Christopher C. Lo, E. Robert McDonald 3rd, Jordi Ginesta Barretina, Ellen T. Gelfand, Craig M. Bielski, Hao-Xin Li, Kevin Hu ...Show all 68 authors... , Alexander Y. Andreev-Drakhlin, Jaegil Kim, Julian M. Hess, Brian J. Haas, Francois Aguet, Barbara A. Weir, Michael V. Rothberg, Brenton R. Paolella, Michael Scott Lawrence, Rehan Akbani, Yi-Ling Lu, Hong L. Tiv, Prafulla C. Gokhale, Antoine de Weck, Ali Amin Mansour, Coyin Oh, Juliann Shih, Kevin Hadi, Yanay Rosen, Jonathan Bistline, Kavitha Venkatesan, Anupama Reddy, Dmitriy Sonkin, Manway Liu, Joseph Lehar, Joshua M. Korn, Dale A. Porter, Michael D. Jones, Javad Golji, Giordano Caponigro, Jordan E. Taylor, Caitlin M. Dunning, Amanda L. Creech, Allison C. Warren, James M. McFarland, Mahdi Zamanighomi, Audrey Kauffmann, Nicolas Stransky, Marcin Imielinski, Yosef E. Maruvka, Andrew D. Cherniack, Aviad Tsherniak, Francisca Vazquez, Jacob D. Jaffe, Andrew Alan Lane, David M. Weinstock, Cory M. Johannessen, Michael P. Morrissey, Frank Stegmeier, Robert Schlegel, William Chun Hahn, Gad Getz, Gordon B. Mills, Jesse S. Boehm, Todd Robert Golub, Levi Alexander Garraway, William Raj Sellers; Show fewer authors
Next-generation characterization of the Cancer Cell Line Encyclopedia.
Nature 569:503-508(2019)

PubMed=31378681; DOI=10.1016/j.ccell.2019.07.001; PMCID=PMC7505724
Zhi-Xin Qiu, Hong Li, Zheng-Tao Zhang, Zhen-Feng Zhu, Sheng He, Xu-Jun Wang, Peng-Cheng Wang, Jian-Jie Qin, Li-Ping Zhuang, Wei Wang, Fu-Bo Xie ...Show all 33 authors... , Ying Gu, Ke-Ke Zou, Chao Li, Chun Li, Chen-Hua Wang, Jin Cen, Xiao-Tao Chen, Ya-Jing Shu, Zhao Zhang, Lu-Lu Sun, Li-Hua Min, Yong Fu, Xiao-Wu Huang, Hui Lv, He Zhou, Yuan Ji, Zhi-Gang Zhang, Zhi-Qiang Meng, Xiao-Lei Shi, Hai-Bin Zhang, Yi-Xue Li, Li-Jian Hui; Show fewer authors
A pharmacogenomic landscape in human liver cancers.
Cancer Cell 36:179-193.e11(2019)

Cross-references
Cell line collections (Providers) KCLB; 00761
Cell line databases/resources cancercelllines; CVCL_5089
Cell_Model_Passport; SIDM01439
DepMap; ACH-000537
LIMORE; SNU761
Biological sample resources BioSample; SAMN10987730
Chemistry resources PharmacoDB; SNU761_1481_2019
Encyclopedic resources Wikidata; Q54955261
Gene expression databases ArrayExpress; E-MTAB-2770
GEO; GSM887639
GEO; GSM888729
GEO; GSM1374899
GEO; GSM2551592
Polymorphism and mutation databases Cosmic; 2771601
IARC_TP53; 6312
LiGeA; CCLE_397
Progenetix; CVCL_5089
Entry history
Entry creation04-Apr-2012
Last entry update10-Apr-2025
Version number28