ID   SNU-761
AC   CVCL_5089
SY   SNU761; NCI-SNU-761
DR   ArrayExpress; E-MTAB-2770
DR   BioSample; SAMN10987730
DR   cancercelllines; CVCL_5089
DR   Cell_Model_Passport; SIDM01439
DR   Cosmic; 2771601
DR   DepMap; ACH-000537
DR   GEO; GSM887639
DR   GEO; GSM888729
DR   GEO; GSM1374899
DR   GEO; GSM2551592
DR   IARC_TP53; 6312
DR   KCLB; 00761
DR   LiGeA; CCLE_397
DR   LIMORE; SNU761
DR   PharmacoDB; SNU761_1481_2019
DR   Progenetix; CVCL_5089
DR   Wikidata; Q54955261
RX   PubMed=8824565;
RX   PubMed=11819450;
RX   PubMed=19956504;
RX   PubMed=22460905;
RX   PubMed=26589293;
RX   PubMed=30894373;
RX   PubMed=31063779;
RX   PubMed=31068700;
RX   PubMed=31378681;
WW   https://lccl.zucmanlab.com/hcc/cellLines/SNU761
CC   Part of: Cancer Dependency Map project (DepMap) (includes Cancer Cell Line Encyclopedia - CCLE).
CC   Part of: Liver Cancer Model Repository (LIMORE).
CC   Part of: Seoul National University (SNU) cell line collection.
CC   Population: Korean.
CC   Doubling time: 24 hours (PubMed=11819450); 24.32 hours (PubMed=31378681).
CC   HLA typing: A*11:01,11:01; B*13:01,13:01; C*03:04,03:04 (PubMed=26589293).
CC   Sequence variation: Mutation; HGNC; 11998; TP53; Simple; p.Ser313Glyfs*13 (c.937_968delAGCTCCTCTCCCCAGCCAAAGAAGAAACCACT); Zygosity=Unspecified (PubMed=8824565; PubMed=31378681).
CC   Transformant: NCBI_TaxID; 10407; Hepatitis B virus (HBV).
CC   Omics: Deep exome analysis.
CC   Omics: Genome sequenced.
CC   Omics: miRNA expression profiling.
CC   Omics: Protein expression by reverse-phase protein arrays.
CC   Omics: SNP array analysis.
CC   Omics: Transcriptome analysis by microarray.
CC   Omics: Transcriptome analysis by RNAseq.
CC   Genome ancestry: African=0.61%; Native American=0%; East Asian, North=59.84%; East Asian, South=38.16%; South Asian=0%; European, North=0%; European, South=1.38% (PubMed=30894373).
CC   Derived from site: In situ; Liver; UBERON=UBERON_0002107.
ST   Source(s): KCLB=00761; PubMed=31378681
ST   Amelogenin: X,Y
ST   CSF1PO: 12
ST   D13S317: 10
ST   D16S539: 11
ST   D3S1358: 15,17
ST   D5S818: 9,12
ST   D7S820: 9
ST   FGA: 23,24
ST   TH01: 9
ST   TPOX: 11
ST   vWA: 16
DI   NCIt; C7956; Adult hepatocellular carcinoma
DI   ORDO; Orphanet_210159; Adult hepatocellular carcinoma
OX   NCBI_TaxID=9606; ! Homo sapiens (Human)
SX   Male
AG   49Y
CA   Cancer cell line
DT   Created: 04-04-12; Last updated: 02-05-24; Version: 26
//
RX   PubMed=8824565; DOI=10.1002/(SICI)1097-0215(19960917)67:6<898::AID-IJC22>3.0.CO;2-X;
RA   Kang M.-S., Lee H.-J., Lee J.-H., Ku J.-L., Lee K.P., Kelley M.J.,
RA   Won Y.-J., Kim S.-T., Park J.-G.;
RT   "Mutation of p53 gene in hepatocellular carcinoma cell lines with HBX
RT   DNA.";
RL   Int. J. Cancer 67:898-902(1996).
//
RX   PubMed=11819450; DOI=10.3748/wjg.v5.i4.289; PMCID=PMC4695537;
RA   Lee J.-H., Ku J.-L., Park Y.-J., Lee K.-U., Kim W.-H., Park J.-G.;
RT   "Establishment and characterization of four human hepatocellular
RT   carcinoma cell lines containing hepatitis B virus DNA.";
RL   World J. Gastroenterol. 5:289-295(1999).
//
RX   PubMed=19956504; DOI=10.4143/crt.2005.37.1.1; PMCID=PMC2785416;
RA   Ku J.-L., Park J.-G.;
RT   "Biology of SNU cell lines.";
RL   Cancer Res. Treat. 37:1-19(2005).
//
RX   PubMed=22460905; DOI=10.1038/nature11003; PMCID=PMC3320027;
RA   Barretina J.G., Caponigro G., Stransky N., Venkatesan K., Margolin A.A.,
RA   Kim S., Wilson C.J., Lehar J., Kryukov G.V., Sonkin D., Reddy A.,
RA   Liu M., Murray L., Berger M.F., Monahan J.E., Morais P., Meltzer J.,
RA   Korejwa A., Jane-Valbuena J., Mapa F.A., Thibault J., Bric-Furlong E.,
RA   Raman P., Shipway A., Engels I.H., Cheng J., Yu G.-Y.K., Yu J.-J.,
RA   Aspesi P. Jr., de Silva M., Jagtap K., Jones M.D., Wang L., Hatton C.,
RA   Palescandolo E., Gupta S., Mahan S., Sougnez C., Onofrio R.C.,
RA   Liefeld T., MacConaill L.E., Winckler W., Reich M., Li N.-X., Mesirov J.P.,
RA   Gabriel S.B., Getz G., Ardlie K., Chan V., Myer V.E., Weber B.L.,
RA   Porter J., Warmuth M., Finan P., Harris J.L., Meyerson M.L., Golub T.R.,
RA   Morrissey M.P., Sellers W.R., Schlegel R., Garraway L.A.;
RT   "The Cancer Cell Line Encyclopedia enables predictive modelling of
RT   anticancer drug sensitivity.";
RL   Nature 483:603-607(2012).
//
RX   PubMed=26589293; DOI=10.1186/s13073-015-0240-5; PMCID=PMC4653878;
RA   Scholtalbers J., Boegel S., Bukur T., Byl M., Goerges S., Sorn P.,
RA   Loewer M., Sahin U., Castle J.C.;
RT   "TCLP: an online cancer cell line catalogue integrating HLA type,
RT   predicted neo-epitopes, virus and gene expression.";
RL   Genome Med. 7:118.1-118.7(2015).
//
RX   PubMed=30894373; DOI=10.1158/0008-5472.CAN-18-2747; PMCID=PMC6445675;
RA   Dutil J., Chen Z.-H., Monteiro A.N.A., Teer J.K., Eschrich S.A.;
RT   "An interactive resource to probe genetic diversity and estimated
RT   ancestry in cancer cell lines.";
RL   Cancer Res. 79:1263-1273(2019).
//
RX   PubMed=31063779; DOI=10.1053/j.gastro.2019.05.001;
RA   Caruso S., Calatayud A.-L., Pilet J., La Bella T., Rekik S.,
RA   Imbeaud S., Letouze E., Meunier L., Bayard Q., Rohr-Udilova N.,
RA   Peneau C., Grasl-Kraupp B., de Koning L., Ouine B., Bioulac-Sage P.,
RA   Couchy G., Calderaro J., Nault J.-C., Zucman-Rossi J., Rebouissou S.;
RT   "Analysis of liver cancer cell lines identifies agents with likely
RT   efficacy against hepatocellular carcinoma and markers of response.";
RL   Gastroenterology 157:760-776(2019).
//
RX   PubMed=31068700; DOI=10.1038/s41586-019-1186-3; PMCID=PMC6697103;
RA   Ghandi M., Huang F.W., Jane-Valbuena J., Kryukov G.V., Lo C.C.,
RA   McDonald E.R. 3rd, Barretina J.G., Gelfand E.T., Bielski C.M., Li H.-X.,
RA   Hu K., Andreev-Drakhlin A.Y., Kim J., Hess J.M., Haas B.J., Aguet F.,
RA   Weir B.A., Rothberg M.V., Paolella B.R., Lawrence M.S., Akbani R.,
RA   Lu Y.-L., Tiv H.L., Gokhale P.C., de Weck A., Mansour A.A., Oh C.,
RA   Shih J., Hadi K., Rosen Y., Bistline J., Venkatesan K., Reddy A.,
RA   Sonkin D., Liu M., Lehar J., Korn J.M., Porter D.A., Jones M.D.,
RA   Golji J., Caponigro G., Taylor J.E., Dunning C.M., Creech A.L.,
RA   Warren A.C., McFarland J.M., Zamanighomi M., Kauffmann A.,
RA   Stransky N., Imielinski M., Maruvka Y.E., Cherniack A.D.,
RA   Tsherniak A., Vazquez F., Jaffe J.D., Lane A.A., Weinstock D.M.,
RA   Johannessen C.M., Morrissey M.P., Stegmeier F., Schlegel R.,
RA   Hahn W.C., Getz G., Mills G.B., Boehm J.S., Golub T.R., Garraway L.A.,
RA   Sellers W.R.;
RT   "Next-generation characterization of the Cancer Cell Line
RT   Encyclopedia.";
RL   Nature 569:503-508(2019).
//
RX   PubMed=31378681; DOI=10.1016/j.ccell.2019.07.001; PMCID=PMC7505724;
RA   Qiu Z.-X., Li H., Zhang Z.-T., Zhu Z.-F., He S., Wang X.-J.,
RA   Wang P.-C., Qin J.-J., Zhuang L.-P., Wang W., Xie F.-B., Gu Y.,
RA   Zou K.-K., Li C., Li C., Wang C.-H., Cen J., Chen X.-T., Shu Y.-J.,
RA   Zhang Z., Sun L.-L., Min L.-H., Fu Y., Huang X.-W., Lv H., Zhou H.,
RA   Ji Y., Zhang Z.-G., Meng Z.-Q., Shi X.-L., Zhang H.-B., Li Y.-X.,
RA   Hui L.-J.;
RT   "A pharmacogenomic landscape in human liver cancers.";
RL   Cancer Cell 36:179-193.e11(2019).
//