Cellosaurus logo
expasy logo

Cellosaurus JHOS-2 (CVCL_4647)

[Text][XML][JSON]
Cell line name JHOS-2
Synonyms JHOS2
Accession CVCL_4647
Resource Identification Initiative To cite this cell line use: JHOS-2 (RRID:CVCL_4647)
Comments Part of: Cancer Dependency Map project (DepMap) (includes Cancer Cell Line Encyclopedia - CCLE).
Part of: COSMIC cell lines project.
Population: Japanese.
Doubling time: 61 hours (PubMed=10695020).
Microsatellite instability: Stable (MSS) (Sanger).
Omics: Genomics; DNA methylation analysis.
Omics: Genomics; Whole exome sequencing.
Omics: Genomics; Whole genome sequencing.
Omics: Phenotyping; CRISPR screening.
Omics: Phenotyping; Drug screening.
Omics: Proteomics.
Omics: Proteomics; Quantitative.
Omics: Transcriptomics; Microarray.
Omics: Transcriptomics; RNAseq.
Omics: Variations; SNP array analysis.
Derived from site: Metastatic; Lymph node; UBERON=UBERON_0000029.
Sequence variations
  • Mutation; HGNC; HGNC:11998; TP53; Simple; c.767_782+4delTGACCTGGAGTCTTCCAGTG; Zygosity=Unspecified (Cosmic-CLP=1479995; DepMap=ACH-000132).
Genome ancestry Source: PubMed=30894373

Origin% genome
African0
Native American0.18
East Asian, North83.51
East Asian, South14.94
South Asian0.69
European, North0
European, South0.68
Disease High grade ovarian serous adenocarcinoma (NCIt: C105555)
Species of origin Homo sapiens (Human) (NCBI Taxonomy: 9606)
Sex of cell Female
Age at sampling 45Y
Category Cancer cell line
STR profile Source(s): Cosmic-CLP=1479995; PubMed=30485824; RCB=RCB1521

Markers:
AmelogeninX
CSF1PO11
D5S81810
D7S82011
D13S3178,9
D16S53913
D21S1131,31.2
TH016,7
TPOX8,11
vWA14,17

Run an STR similarity search on this cell line
Publications

PubMed=10695020
Kyosuke Yamada, Toshiaki Tachibana, Hisashi Hashimoto, Keitaro Suzuki, Satoshi Yanagida, Hisae Endoh, Eizo Kimura, Makoto Yasuda, Tadao Tanaka, Hiroshi Ishikawa;
Establishment and characterization of cell lines derived from serous adenocarcinoma (JHOS-2) and clear cell adenocarcinoma (JHOC-5, JHOC-6) of human ovary.
Hum. Cell 12:131-138(1999)

PubMed=22460905; DOI=10.1038/nature11003; PMCID=PMC3320027
Jordi Ginesta Barretina, Giordano Caponigro, Nicolas Stransky, Kavitha Venkatesan, Adam A. Margolin, Sungjoon Kim, Christopher J. Wilson, Joseph Lehar, Gregory V. Kryukov, Dmitriy Sonkin, Anupama Reddy ...Show all 61 authors... , Manway Liu, Lauren Murray, Michael F. Berger, John E. Monahan, Paula Morais, Jodi Meltzer, Adam Korejwa, Judit Jane-Valbuena, Felipa A. Mapa, Joseph Thibault, Eva Bric-Furlong, Pichai Raman, Aaron Shipway, Ingo H. Engels, Jill Cheng, Guo-Ying K. Yu, Jian-Jun Yu, Peter Aspesi Jr., Melanie de Silva, Kalpana Jagtap, Michael D. Jones, Li Wang, Charles Hatton, Emanuele Palescandolo, Supriya Gupta, Scott Mahan, Carrie Sougnez, Robert C. Onofrio, Ted Liefeld, Laura E. MacConaill, Wendy Winckler, Michael Reich, Nan-Xin Li, Jill P. Mesirov, Stacey B. Gabriel, Gad Getz, Kristin Ardlie, Vivien Chan, Vic E. Myer, Barbara L. Weber, Jeff Porter, Markus Warmuth, Peter Finan, Jennifer L. Harris, Matthew Langer Meyerson, Todd Robert Golub, Michael P. Morrissey, William Raj Sellers, Robert Schlegel, Levi Alexander Garraway; Show fewer authors
The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug sensitivity.
Nature 483:603-607(2012)

PubMed=23839242; DOI=10.1038/ncomms3126; PMCID=PMC3715866
Silvia Domcke, Rileen Sinha, Douglas A. Levine, Chris Sander, Nikolaus Schultz;
Evaluating cell lines as tumour models by comparison of genomic profiles.
Nat. Commun. 4:2126.1-2126.10(2013)

PubMed=27397505; DOI=10.1016/j.cell.2016.06.017; PMCID=PMC4967469
Francesco Iorio, Theo A. Knijnenburg, Daniel J. Vis, Graham Robert Bignell, Michael Patrick Menden, Michael Schubert, Nanne Aben, Emanuel Goncalves, Syd Barthorpe, Howard Lightfoot, Thomas Cokelaer ...Show all 39 authors... , Patricia Greninger, Ewald van Dyk, Han Chang, Heshani de Silva, Holger Heyn, Xian-Ming Deng, Regina K. Egan, Qing-Song Liu, Tatiana Mironenko, Xeni Mitropoulos, Laura Richardson, Jin-Hua Wang, Ting-Hu Zhang, Sebastian Moran, Sergi Sayols, Maryam Soleimani, David Tamborero, Nuria Lopez-Bigas, Petra Ross-Macdonald, Manel Esteller, Nathanael S. Gray, Daniel Arie Haber, Michael Rudolf Stratton, Cyril Henri Benes, Lodewyk F.A. Wessels, Julio Saez-Rodriguez, Ultan McDermott, Mathew J. Garnett; Show fewer authors
A landscape of pharmacogenomic interactions in cancer.
Cell 166:740-754(2016)

PubMed=27561551; DOI=10.1038/ncomms12645; PMCID=PMC5007461
Fabian Coscia, Karen M. Watters, Marion Curtis, Mark A. Eckert, Chun-Yi Chiang, Stefka Tyanova, Anthony Montag, Ricardo R. Lastra, Ernst Robert Lengyel, Matthias Mann;
Integrative proteomic profiling of ovarian cancer cell lines reveals precursor cell associated proteins and functional status.
Nat. Commun. 7:12645.1-12645.14(2016)

PubMed=30485824; DOI=10.1016/j.celrep.2018.10.096; PMCID=PMC6481945
Eniko Papp, Dorothy Hallberg, Gottfried E. Konecny, Daniel C. Bruhm, Vilmos Adleff, Michael Noe, Ioannis Kagiampakis, Doreen Palsgrove, Dylan Conklin, Yasuto Kinose, James R. White ...Show all 18 authors... , Michael F. Press, Ronny I. Drapkin, Hariharan Easwaran, Stephen Bruce Baylin, Dennis Joseph Slamon, Victor E. Velculescu, Robert B. Scharpf; Show fewer authors
Integrated genomic, epigenomic, and expression analyses of ovarian cancer cell lines.
Cell Rep. 25:2617-2633(2018)

PubMed=30894373; DOI=10.1158/0008-5472.CAN-18-2747; PMCID=PMC6445675
Julie Dutil, Zhi-Hua Chen, Alvaro N.A. Monteiro, Jamie K. Teer, Steven A. Eschrich;
An interactive resource to probe genetic diversity and estimated ancestry in cancer cell lines.
Cancer Res. 79:1263-1273(2019)

PubMed=30971826; DOI=10.1038/s41586-019-1103-9
Fiona M. Behan, Francesco Iorio, Gabriele Picco, Emanuel Goncalves, Charlotte M. Beaver, Giorgia Migliardi, Rita Santos, Yanhua Rao, Francesco Sassi, Marika Pinnelli, Rizwan Ansari ...Show all 25 authors... , Sarah Harper, David Adam Jackson, Rebecca McRae, Rachel Pooley, Piers Wilkinson, Dieudonne J. van der Meer, David Dow, Carolyn A. Buser-Doepner, Andrea Bertotti, Livio Trusolino, Euan Alexander Stronach, Julio Saez-Rodriguez, Kosuke Yusa, Mathew J. Garnett; Show fewer authors
Prioritization of cancer therapeutic targets using CRISPR-Cas9 screens.
Nature 568:511-516(2019)

PubMed=31068700; DOI=10.1038/s41586-019-1186-3; PMCID=PMC6697103
Mahmoud Ghandi, Franklin W. Huang, Judit Jane-Valbuena, Gregory V. Kryukov, Christopher C. Lo, E. Robert McDonald 3rd, Jordi Ginesta Barretina, Ellen T. Gelfand, Craig M. Bielski, Hao-Xin Li, Kevin Hu ...Show all 68 authors... , Alexander Y. Andreev-Drakhlin, Jaegil Kim, Julian M. Hess, Brian J. Haas, Francois Aguet, Barbara A. Weir, Michael V. Rothberg, Brenton R. Paolella, Michael Scott Lawrence, Rehan Akbani, Yi-Ling Lu, Hong L. Tiv, Prafulla C. Gokhale, Antoine de Weck, Ali Amin Mansour, Coyin Oh, Juliann Shih, Kevin Hadi, Yanay Rosen, Jonathan Bistline, Kavitha Venkatesan, Anupama Reddy, Dmitriy Sonkin, Manway Liu, Joseph Lehar, Joshua M. Korn, Dale A. Porter, Michael D. Jones, Javad Golji, Giordano Caponigro, Jordan E. Taylor, Caitlin M. Dunning, Amanda L. Creech, Allison C. Warren, James M. McFarland, Mahdi Zamanighomi, Audrey Kauffmann, Nicolas Stransky, Marcin Imielinski, Yosef E. Maruvka, Andrew D. Cherniack, Aviad Tsherniak, Francisca Vazquez, Jacob D. Jaffe, Andrew Alan Lane, David M. Weinstock, Cory M. Johannessen, Michael P. Morrissey, Frank Stegmeier, Robert Schlegel, William Chun Hahn, Gad Getz, Gordon B. Mills, Jesse S. Boehm, Todd Robert Golub, Levi Alexander Garraway, William Raj Sellers; Show fewer authors
Next-generation characterization of the Cancer Cell Line Encyclopedia.
Nature 569:503-508(2019)

PubMed=35839778; DOI=10.1016/j.ccell.2022.06.010; PMCID=PMC9387775
Emanuel Goncalves, Rebecca C. Poulos, Zhao-Xiang Cai, Syd Barthorpe, Srikanth S. Manda, Natasha Lucas, Alexandra Beck, Daniel Bucio-Noble, Michael Dausmann, Caitlin Hall, Michael Hecker ...Show all 32 authors... , Jennifer Koh, Howard Lightfoot, Sadia Mahboob, Iman Mali, James Morris, Laura Richardson, Akila J. Seneviratne, Rebecca Shepherd, Erin Sykes, Frances Thomas, Sara Valentini, Steven G. Williams, Yang-Xiu Wu, Dylan Xavier, Karen L. MacKenzie, Peter G. Hains, Brett Tully, Phillip James Robinson, Qing Zhong, Mathew J. Garnett, Roger Robert Reddel; Show fewer authors
Pan-cancer proteomic map of 949 human cell lines.
Cancer Cell 40:835-849.e8(2022)

Cross-references
Cell line collections (Providers) RCB; RCB1521
Cell line databases/resources CLO; CLO_0051440
cancercelllines; CVCL_4647
Cell_Model_Passport; SIDM00305
Cosmic-CLP; 1479995
DepMap; ACH-000132
Biological sample resources BioSample; SAMN03472150
BioSample; SAMN10988178
CRISP screens repositories BioGRID_ORCS_Cell_line; 904
Chemistry resources GDSC; 1479995
PharmacoDB; JHOS2_689_2019
Encyclopedic resources Wikidata; Q54898657
Gene expression databases ArrayExpress; E-MTAB-2770
ArrayExpress; E-MTAB-3610
FANTOM5_SSTAR; 10639-108I9
GEO; GSM711695
GEO; GSM887178
GEO; GSM888250
GEO; GSM1669955
Polymorphism and mutation databases Cosmic; 1066215
IARC_TP53; 28295
LiGeA; CCLE_154
Progenetix; CVCL_4647
Proteomic databases PRIDE; PXD003668
PRIDE; PXD030304
Sequence databases EGA; EGAS00001000978
Entry history
Entry creation04-Apr-2012
Last entry update10-Apr-2025
Version number33