Cellosaurus logo
expasy logo

Cellosaurus JHOS-2 (CVCL_4647)

[Text version]
Cell line name JHOS-2
Synonyms JHOS2
Accession CVCL_4647
Resource Identification Initiative To cite this cell line use: JHOS-2 (RRID:CVCL_4647)
Comments Part of: Cancer Dependency Map project (DepMap) (includes Cancer Cell Line Encyclopedia - CCLE).
Part of: COSMIC cell lines project.
Population: Japanese.
Doubling time: 61 hours (PubMed=10695020).
Microsatellite instability: Stable (MSS) (Sanger).
Omics: Genomics; DNA methylation analysis.
Omics: Genomics; Whole exome sequencing.
Omics: Genomics; Whole genome sequencing.
Omics: Phenotyping; CRISPR screening.
Omics: Phenotyping; Drug screening.
Omics: Proteomics.
Omics: Proteomics; Quantitative.
Omics: Transcriptomics; Microarray.
Omics: Transcriptomics; RNAseq.
Omics: Variations; SNP array analysis.
Derived from site: Metastatic; Lymph node; UBERON=UBERON_0000029.
Sequence variations
  • Mutation; HGNC; HGNC:11998; TP53; Simple; c.767_782+4delTGACCTGGAGTCTTCCAGTG; Zygosity=Unspecified (Cosmic-CLP=1479995; DepMap=ACH-000132).
Genome ancestry Source: PubMed=30894373

Origin% genome
African0
Native American0.18
East Asian, North83.51
East Asian, South14.94
South Asian0.69
European, North0
European, South0.68
Disease High grade ovarian serous adenocarcinoma (NCIt: C105555)
Species of origin Homo sapiens (Human) (NCBI Taxonomy: 9606)
Sex of cell Female
Age at sampling 45Y
Category Cancer cell line
STR profile Source(s): Cosmic-CLP=1479995; PubMed=30485824; RCB=RCB1521

Markers:
AmelogeninX
CSF1PO11
D5S81810
D7S82011
D13S3178,9
D16S53913
D21S1131,31.2
TH016,7
TPOX8,11
vWA14,17

Run an STR similarity search on this cell line
Publications

PubMed=10695020
Yamada K., Tachibana T., Hashimoto H., Suzuki K., Yanagida S., Endoh H., Kimura E., Yasuda M., Tanaka T., Ishikawa H.
Establishment and characterization of cell lines derived from serous adenocarcinoma (JHOS-2) and clear cell adenocarcinoma (JHOC-5, JHOC-6) of human ovary.
Hum. Cell 12:131-138(1999)

PubMed=22460905; DOI=10.1038/nature11003; PMCID=PMC3320027
Barretina J.G., Caponigro G., Stransky N., Venkatesan K., Margolin A.A., Kim S., Wilson C.J., Lehar J., Kryukov G.V., Sonkin D., Reddy A., Liu M., Murray L., Berger M.F., Monahan J.E., Morais P., Meltzer J., Korejwa A., Jane-Valbuena J., Mapa F.A., Thibault J., Bric-Furlong E., Raman P., Shipway A., Engels I.H., Cheng J., Yu G.-Y.K., Yu J.-J., Aspesi P. Jr., de Silva M., Jagtap K., Jones M.D., Wang L., Hatton C., Palescandolo E., Gupta S., Mahan S., Sougnez C., Onofrio R.C., Liefeld T., MacConaill L.E., Winckler W., Reich M., Li N.-X., Mesirov J.P., Gabriel S.B., Getz G., Ardlie K., Chan V., Myer V.E., Weber B.L., Porter J., Warmuth M., Finan P., Harris J.L., Meyerson M.L., Golub T.R., Morrissey M.P., Sellers W.R., Schlegel R., Garraway L.A.
The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug sensitivity.
Nature 483:603-607(2012)

PubMed=23839242; DOI=10.1038/ncomms3126; PMCID=PMC3715866
Domcke S., Sinha R., Levine D.A., Sander C., Schultz N.
Evaluating cell lines as tumour models by comparison of genomic profiles.
Nat. Commun. 4:2126.1-2126.10(2013)

PubMed=27397505; DOI=10.1016/j.cell.2016.06.017; PMCID=PMC4967469
Iorio F., Knijnenburg T.A., Vis D.J., Bignell G.R., Menden M.P., Schubert M., Aben N., Goncalves E., Barthorpe S., Lightfoot H., Cokelaer T., Greninger P., van Dyk E., Chang H., de Silva H., Heyn H., Deng X.-M., Egan R.K., Liu Q.-S., Mironenko T., Mitropoulos X., Richardson L., Wang J.-H., Zhang T.-H., Moran S., Sayols S., Soleimani M., Tamborero D., Lopez-Bigas N., Ross-Macdonald P., Esteller M., Gray N.S., Haber D.A., Stratton M.R., Benes C.H., Wessels L.F.A., Saez-Rodriguez J., McDermott U., Garnett M.J.
A landscape of pharmacogenomic interactions in cancer.
Cell 166:740-754(2016)

PubMed=27561551; DOI=10.1038/ncomms12645; PMCID=PMC5007461
Coscia F., Watters K.M., Curtis M., Eckert M.A., Chiang C.-Y., Tyanova S., Montag A., Lastra R.R., Lengyel E., Mann M.
Integrative proteomic profiling of ovarian cancer cell lines reveals precursor cell associated proteins and functional status.
Nat. Commun. 7:12645.1-12645.14(2016)

PubMed=30485824; DOI=10.1016/j.celrep.2018.10.096; PMCID=PMC6481945
Papp E., Hallberg D., Konecny G.E., Bruhm D.C., Adleff V., Noe M., Kagiampakis I., Palsgrove D., Conklin D., Kinose Y., White J.R., Press M.F., Drapkin R.I., Easwaran H., Baylin S.B., Slamon D.J., Velculescu V.E., Scharpf R.B.
Integrated genomic, epigenomic, and expression analyses of ovarian cancer cell lines.
Cell Rep. 25:2617-2633(2018)

PubMed=30894373; DOI=10.1158/0008-5472.CAN-18-2747; PMCID=PMC6445675
Dutil J., Chen Z.-H., Monteiro A.N.A., Teer J.K., Eschrich S.A.
An interactive resource to probe genetic diversity and estimated ancestry in cancer cell lines.
Cancer Res. 79:1263-1273(2019)

PubMed=30971826; DOI=10.1038/s41586-019-1103-9
Behan F.M., Iorio F., Picco G., Goncalves E., Beaver C.M., Migliardi G., Santos R., Rao Y., Sassi F., Pinnelli M., Ansari R., Harper S., Jackson D.A., McRae R., Pooley R., Wilkinson P., van der Meer D.J., Dow D., Buser-Doepner C.A., Bertotti A., Trusolino L., Stronach E.A., Saez-Rodriguez J., Yusa K., Garnett M.J.
Prioritization of cancer therapeutic targets using CRISPR-Cas9 screens.
Nature 568:511-516(2019)

PubMed=31068700; DOI=10.1038/s41586-019-1186-3; PMCID=PMC6697103
Ghandi M., Huang F.W., Jane-Valbuena J., Kryukov G.V., Lo C.C., McDonald E.R. 3rd, Barretina J.G., Gelfand E.T., Bielski C.M., Li H.-X., Hu K., Andreev-Drakhlin A.Y., Kim J., Hess J.M., Haas B.J., Aguet F., Weir B.A., Rothberg M.V., Paolella B.R., Lawrence M.S., Akbani R., Lu Y.-L., Tiv H.L., Gokhale P.C., de Weck A., Mansour A.A., Oh C., Shih J., Hadi K., Rosen Y., Bistline J., Venkatesan K., Reddy A., Sonkin D., Liu M., Lehar J., Korn J.M., Porter D.A., Jones M.D., Golji J., Caponigro G., Taylor J.E., Dunning C.M., Creech A.L., Warren A.C., McFarland J.M., Zamanighomi M., Kauffmann A., Stransky N., Imielinski M., Maruvka Y.E., Cherniack A.D., Tsherniak A., Vazquez F., Jaffe J.D., Lane A.A., Weinstock D.M., Johannessen C.M., Morrissey M.P., Stegmeier F., Schlegel R., Hahn W.C., Getz G., Mills G.B., Boehm J.S., Golub T.R., Garraway L.A., Sellers W.R.
Next-generation characterization of the Cancer Cell Line Encyclopedia.
Nature 569:503-508(2019)

PubMed=35839778; DOI=10.1016/j.ccell.2022.06.010; PMCID=PMC9387775
Goncalves E., Poulos R.C., Cai Z.-X., Barthorpe S., Manda S.S., Lucas N., Beck A., Bucio-Noble D., Dausmann M., Hall C., Hecker M., Koh J., Lightfoot H., Mahboob S., Mali I., Morris J., Richardson L., Seneviratne A.J., Shepherd R., Sykes E., Thomas F., Valentini S., Williams S.G., Wu Y.-X., Xavier D., MacKenzie K.L., Hains P.G., Tully B., Robinson P.J., Zhong Q., Garnett M.J., Reddel R.R.
Pan-cancer proteomic map of 949 human cell lines.
Cancer Cell 40:835-849.e8(2022)

Cross-references
Cell line collections (Providers) RCB; RCB1521
Cell line databases/resources CLO; CLO_0051440
cancercelllines; CVCL_4647
Cell_Model_Passport; SIDM00305
Cosmic-CLP; 1479995
DepMap; ACH-000132
Biological sample resources BioSample; SAMN03472150
BioSample; SAMN10988178
CRISP screens repositories BioGRID_ORCS_Cell_line; 904
Chemistry resources GDSC; 1479995
PharmacoDB; JHOS2_689_2019
Encyclopedic resources Wikidata; Q54898657
Gene expression databases ArrayExpress; E-MTAB-2770
ArrayExpress; E-MTAB-3610
FANTOM5_SSTAR; 10639-108I9
GEO; GSM711695
GEO; GSM887178
GEO; GSM888250
GEO; GSM1669955
Polymorphism and mutation databases Cosmic; 1066215
IARC_TP53; 28295
LiGeA; CCLE_154
Progenetix; CVCL_4647
Proteomic databases PRIDE; PXD003668
PRIDE; PXD030304
Sequence databases EGA; EGAS00001000978
Entry history
Entry creation04-Apr-2012
Last entry update10-Apr-2025
Version number33