ID   JHOS-2
AC   CVCL_4647
SY   JHOS2
DR   CLO; CLO_0051440
DR   ArrayExpress; E-MTAB-2770
DR   ArrayExpress; E-MTAB-3610
DR   BioGRID_ORCS_Cell_line; 904
DR   BioSample; SAMN03472150
DR   BioSample; SAMN10988178
DR   cancercelllines; CVCL_4647
DR   Cell_Model_Passport; SIDM00305
DR   Cosmic; 1066215
DR   Cosmic-CLP; 1479995
DR   DepMap; ACH-000132
DR   EGA; EGAS00001000978
DR   FANTOM5_SSTAR; 10639-108I9
DR   GDSC; 1479995
DR   GEO; GSM711695
DR   GEO; GSM887178
DR   GEO; GSM888250
DR   GEO; GSM1669955
DR   IARC_TP53; 28295
DR   LiGeA; CCLE_154
DR   PharmacoDB; JHOS2_689_2019
DR   PRIDE; PXD003668
DR   PRIDE; PXD030304
DR   Progenetix; CVCL_4647
DR   RCB; RCB1521
DR   Wikidata; Q54898657
RX   PubMed=10695020;
RX   PubMed=22460905;
RX   PubMed=23839242;
RX   PubMed=27397505;
RX   PubMed=27561551;
RX   PubMed=30485824;
RX   PubMed=30894373;
RX   PubMed=30971826;
RX   PubMed=31068700;
RX   PubMed=35839778;
CC   Part of: Cancer Dependency Map project (DepMap) (includes Cancer Cell Line Encyclopedia - CCLE).
CC   Part of: COSMIC cell lines project.
CC   Population: Japanese.
CC   Doubling time: 61 hours (PubMed=10695020).
CC   Microsatellite instability: Stable (MSS) (Sanger).
CC   Sequence variation: Mutation; HGNC; HGNC:11998; TP53; Simple; c.767_782+4delTGACCTGGAGTCTTCCAGTG; Zygosity=Unspecified (Cosmic-CLP=1479995; DepMap=ACH-000132).
CC   Omics: Genomics; DNA methylation analysis.
CC   Omics: Genomics; Whole exome sequencing.
CC   Omics: Genomics; Whole genome sequencing.
CC   Omics: Phenotyping; CRISPR screening.
CC   Omics: Phenotyping; Drug screening.
CC   Omics: Proteomics.
CC   Omics: Proteomics; Quantitative.
CC   Omics: Transcriptomics; Microarray.
CC   Omics: Transcriptomics; RNAseq.
CC   Omics: Variations; SNP array analysis.
CC   Genome ancestry: African=0%; Native American=0.18%; East Asian, North=83.51%; East Asian, South=14.94%; South Asian=0.69%; European, North=0%; European, South=0.68% (PubMed=30894373).
CC   Derived from site: Metastatic; Lymph node; UBERON=UBERON_0000029.
ST   Source(s): Cosmic-CLP=1479995; PubMed=30485824; RCB=RCB1521
ST   Amelogenin: X
ST   CSF1PO: 11
ST   D13S317: 8,9
ST   D16S539: 13
ST   D21S11: 31,31.2
ST   D5S818: 10
ST   D7S820: 11
ST   TH01: 6,7
ST   TPOX: 8,11
ST   vWA: 14,17
DI   NCIt; C105555; High grade ovarian serous adenocarcinoma
OX   NCBI_TaxID=9606; ! Homo sapiens (Human)
SX   Female
AG   45Y
CA   Cancer cell line
DT   Created: 04-04-12; Last updated: 10-04-25; Version: 33
//
RX   PubMed=10695020;
RA   Yamada K., Tachibana T., Hashimoto H., Suzuki K., Yanagida S.,
RA   Endoh H., Kimura E., Yasuda M., Tanaka T., Ishikawa H.;
RT   "Establishment and characterization of cell lines derived from serous
RT   adenocarcinoma (JHOS-2) and clear cell adenocarcinoma (JHOC-5, JHOC-6)
RT   of human ovary.";
RL   Hum. Cell 12:131-138(1999).
//
RX   PubMed=22460905; DOI=10.1038/nature11003; PMCID=PMC3320027;
RA   Barretina J.G., Caponigro G., Stransky N., Venkatesan K., Margolin A.A.,
RA   Kim S., Wilson C.J., Lehar J., Kryukov G.V., Sonkin D., Reddy A.,
RA   Liu M., Murray L., Berger M.F., Monahan J.E., Morais P., Meltzer J.,
RA   Korejwa A., Jane-Valbuena J., Mapa F.A., Thibault J., Bric-Furlong E.,
RA   Raman P., Shipway A., Engels I.H., Cheng J., Yu G.-Y.K., Yu J.-J.,
RA   Aspesi P. Jr., de Silva M., Jagtap K., Jones M.D., Wang L., Hatton C.,
RA   Palescandolo E., Gupta S., Mahan S., Sougnez C., Onofrio R.C.,
RA   Liefeld T., MacConaill L.E., Winckler W., Reich M., Li N.-X., Mesirov J.P.,
RA   Gabriel S.B., Getz G., Ardlie K., Chan V., Myer V.E., Weber B.L.,
RA   Porter J., Warmuth M., Finan P., Harris J.L., Meyerson M.L., Golub T.R.,
RA   Morrissey M.P., Sellers W.R., Schlegel R., Garraway L.A.;
RT   "The Cancer Cell Line Encyclopedia enables predictive modelling of
RT   anticancer drug sensitivity.";
RL   Nature 483:603-607(2012).
//
RX   PubMed=23839242; DOI=10.1038/ncomms3126; PMCID=PMC3715866;
RA   Domcke S., Sinha R., Levine D.A., Sander C., Schultz N.;
RT   "Evaluating cell lines as tumour models by comparison of genomic
RT   profiles.";
RL   Nat. Commun. 4:2126.1-2126.10(2013).
//
RX   PubMed=27397505; DOI=10.1016/j.cell.2016.06.017; PMCID=PMC4967469;
RA   Iorio F., Knijnenburg T.A., Vis D.J., Bignell G.R., Menden M.P.,
RA   Schubert M., Aben N., Goncalves E., Barthorpe S., Lightfoot H.,
RA   Cokelaer T., Greninger P., van Dyk E., Chang H., de Silva H., Heyn H.,
RA   Deng X.-M., Egan R.K., Liu Q.-S., Mironenko T., Mitropoulos X.,
RA   Richardson L., Wang J.-H., Zhang T.-H., Moran S., Sayols S.,
RA   Soleimani M., Tamborero D., Lopez-Bigas N., Ross-Macdonald P.,
RA   Esteller M., Gray N.S., Haber D.A., Stratton M.R., Benes C.H.,
RA   Wessels L.F.A., Saez-Rodriguez J., McDermott U., Garnett M.J.;
RT   "A landscape of pharmacogenomic interactions in cancer.";
RL   Cell 166:740-754(2016).
//
RX   PubMed=27561551; DOI=10.1038/ncomms12645; PMCID=PMC5007461;
RA   Coscia F., Watters K.M., Curtis M., Eckert M.A., Chiang C.-Y.,
RA   Tyanova S., Montag A., Lastra R.R., Lengyel E., Mann M.;
RT   "Integrative proteomic profiling of ovarian cancer cell lines reveals
RT   precursor cell associated proteins and functional status.";
RL   Nat. Commun. 7:12645.1-12645.14(2016).
//
RX   PubMed=30485824; DOI=10.1016/j.celrep.2018.10.096; PMCID=PMC6481945;
RA   Papp E., Hallberg D., Konecny G.E., Bruhm D.C., Adleff V., Noe M.,
RA   Kagiampakis I., Palsgrove D., Conklin D., Kinose Y., White J.R.,
RA   Press M.F., Drapkin R.I., Easwaran H., Baylin S.B., Slamon D.J.,
RA   Velculescu V.E., Scharpf R.B.;
RT   "Integrated genomic, epigenomic, and expression analyses of ovarian
RT   cancer cell lines.";
RL   Cell Rep. 25:2617-2633(2018).
//
RX   PubMed=30894373; DOI=10.1158/0008-5472.CAN-18-2747; PMCID=PMC6445675;
RA   Dutil J., Chen Z.-H., Monteiro A.N.A., Teer J.K., Eschrich S.A.;
RT   "An interactive resource to probe genetic diversity and estimated
RT   ancestry in cancer cell lines.";
RL   Cancer Res. 79:1263-1273(2019).
//
RX   PubMed=30971826; DOI=10.1038/s41586-019-1103-9;
RA   Behan F.M., Iorio F., Picco G., Goncalves E., Beaver C.M.,
RA   Migliardi G., Santos R., Rao Y., Sassi F., Pinnelli M., Ansari R.,
RA   Harper S., Jackson D.A., McRae R., Pooley R., Wilkinson P.,
RA   van der Meer D.J., Dow D., Buser-Doepner C.A., Bertotti A., Trusolino L.,
RA   Stronach E.A., Saez-Rodriguez J., Yusa K., Garnett M.J.;
RT   "Prioritization of cancer therapeutic targets using CRISPR-Cas9
RT   screens.";
RL   Nature 568:511-516(2019).
//
RX   PubMed=31068700; DOI=10.1038/s41586-019-1186-3; PMCID=PMC6697103;
RA   Ghandi M., Huang F.W., Jane-Valbuena J., Kryukov G.V., Lo C.C.,
RA   McDonald E.R. 3rd, Barretina J.G., Gelfand E.T., Bielski C.M., Li H.-X.,
RA   Hu K., Andreev-Drakhlin A.Y., Kim J., Hess J.M., Haas B.J., Aguet F.,
RA   Weir B.A., Rothberg M.V., Paolella B.R., Lawrence M.S., Akbani R.,
RA   Lu Y.-L., Tiv H.L., Gokhale P.C., de Weck A., Mansour A.A., Oh C.,
RA   Shih J., Hadi K., Rosen Y., Bistline J., Venkatesan K., Reddy A.,
RA   Sonkin D., Liu M., Lehar J., Korn J.M., Porter D.A., Jones M.D.,
RA   Golji J., Caponigro G., Taylor J.E., Dunning C.M., Creech A.L.,
RA   Warren A.C., McFarland J.M., Zamanighomi M., Kauffmann A.,
RA   Stransky N., Imielinski M., Maruvka Y.E., Cherniack A.D.,
RA   Tsherniak A., Vazquez F., Jaffe J.D., Lane A.A., Weinstock D.M.,
RA   Johannessen C.M., Morrissey M.P., Stegmeier F., Schlegel R.,
RA   Hahn W.C., Getz G., Mills G.B., Boehm J.S., Golub T.R., Garraway L.A.,
RA   Sellers W.R.;
RT   "Next-generation characterization of the Cancer Cell Line
RT   Encyclopedia.";
RL   Nature 569:503-508(2019).
//
RX   PubMed=35839778; DOI=10.1016/j.ccell.2022.06.010; PMCID=PMC9387775;
RA   Goncalves E., Poulos R.C., Cai Z.-X., Barthorpe S., Manda S.S., Lucas N.,
RA   Beck A., Bucio-Noble D., Dausmann M., Hall C., Hecker M., Koh J.,
RA   Lightfoot H., Mahboob S., Mali I., Morris J., Richardson L.,
RA   Seneviratne A.J., Shepherd R., Sykes E., Thomas F., Valentini S.,
RA   Williams S.G., Wu Y.-X., Xavier D., MacKenzie K.L., Hains P.G., Tully B.,
RA   Robinson P.J., Zhong Q., Garnett M.J., Reddel R.R.;
RT   "Pan-cancer proteomic map of 949 human cell lines.";
RL   Cancer Cell 40:835-849.e8(2022).
//