Cellosaurus logo
expasy logo

Cellosaurus KOB (CVCL_VN49)

[Text][XML][JSON]
Cell line name KOB
Accession CVCL_VN49
Resource Identification Initiative To cite this cell line use: KOB (RRID:CVCL_VN49)
Comments Population: Japanese.
Transformant: NCBI_TaxID; 11908; Human T-lymphotropic virus 1 (HTLV-1).
Derived from site: In situ; Ascites; UBERON=UBERON_0007795.
Cell type: T-cell; CL=CL_0000084.
Sequence variations
  • Mutation; HGNC; HGNC:11920; FAS; Simple; p.Leu229Tyrfs (c.686_705delTGAGTAAATATATCACCACT); Zygosity=Heterozygous (PubMed=10190897).
  • Mutation; HGNC; HGNC:9065; PLCG1; Simple; p.Arg48Trp (c.142C>T); Zygosity=Heterozygous (CelloPub=CLPUB00592).
  • Mutation; HGNC; HGNC:9065; PLCG1; Simple; p.Met750Val (c.2248A>G); Zygosity=Heterozygous (CelloPub=CLPUB00592).
Disease Adult T-cell leukemia/lymphoma (NCIt: C3184)
Adult T-cell leukemia/lymphoma (ORDO: Orphanet_86875)
Species of origin Homo sapiens (Human) (NCBI Taxonomy: 9606)
Sex of cell Male
Age at sampling 72Y
Category Cancer cell line
Publications

PubMed=10190897; DOI=10.1084/jem.189.7.1063; PMCID=PMC2193006
Takahiro Maeda, Yasuaki Yamada, Ryouzou Moriuchi, Kazuyuki Sugahara, Kazuto Tsuruda, Tatsurou Joh, Sunao Atogami, Kunihiro Tsukasaki, Masao Tomonaga, Shimeru Kamihira;
Fas gene mutation in the progression of adult T cell leukemia.
J. Exp. Med. 189:1063-1071(1999)

PubMed=15638862; DOI=10.1111/j.1365-2141.2004.05289.x
Hiroo Hasegawa, Yasuaki Yamada, Hitomi Harasawa, Tomohiro Tsuji, Ken Murata, Kazuyuki Sugahara, Kazuto Tsuruda, Shuichi Ikeda, Yoshitaka Imaizumi, Masao Tomonaga, Masoto Masuda ...Show all 13 authors... , Nobuyuki Takasu, Shimeru Kamihira; Show fewer authors
Sensitivity of adult T-cell leukaemia lymphoma cells to tumour necrosis factor-related apoptosis-inducing ligand.
Br. J. Haematol. 128:253-265(2005)

PubMed=19220422; DOI=10.1111/j.1600-0609.2009.01211.x
Shimeru Kamihira, Chiharu Terada, Daisuke Sasaki, Katsunori Yanagihara, Kunihiro Tsukasaki, Hiroo Hasegawa, Yasuaki Yamada;
Aberrant p53 protein expression and function in a panel of hematopoietic cell lines with different p53 mutations.
Eur. J. Haematol. 82:301-307(2009)

PubMed=19710698; DOI=10.1038/leu.2009.171
Hiroo Hasegawa, Yasuaki Yamada, Hidekatsu Iha, Kunihiro Tsukasaki, Kazuhiro Nagai, Sunao Atogami, Kazuyuki Sugahara, Kazuto Tsuruda, Akiko Ishizaki, Shimeru Kamihira;
Activation of p53 by Nutlin-3a, an antagonist of MDM2, induces apoptosis and cellular senescence in adult T-cell leukemia cells.
Leukemia 23:2090-2101(2009)

PubMed=27193821; DOI=10.1111/cas.12971; PMCID=PMC4982578
Hiroo Hasegawa, Reid P. Bissonnette, Mireille Gillings, Daisuke Sasaki, Hiroaki Taniguchi, Hideaki Kitanosono, Kazuto Tsuruda, Kousuke Kosai, Naoki Uno, Yoshitomo Morinaga, Yoshitaka Imaizumi ...Show all 13 authors... , Yasushi Miyazaki, Katsunori Yanagihara; Show fewer authors
Induction of apoptosis by HBI-8000 in adult T-cell leukemia/lymphoma is associated with activation of Bim and NLRP3.
Cancer Sci. 107:1124-1133(2016)

CLPUB00592
Varsha Maheshkumar Patel;
Functional interrogations of phospholipase c gamma 1 (PLCG1) mutations in Sezary syndrome.
Thesis PhD (2019); King's College London; London; United Kingdom

Cross-references
Encyclopedic resources Wikidata; Q95962168
Polymorphism and mutation databases Cosmic; 2765562
IARC_TP53; 26999
Entry history
Entry creation07-Sep-2018
Last entry update19-Dec-2024
Version number11