Cellosaurus logo
expasy logo

Cellosaurus CCLF-PEDS-0001-T (CVCL_B3PK)

[Text][XML][JSON]
Cell line name CCLF-PEDS-0001-T
Synonyms CCLF_PEDS_0001_T; Peds005T Susp
Accession CVCL_B3PK
Resource Identification Initiative To cite this cell line use: CCLF-PEDS-0001-T (RRID:CVCL_B3PK)
Comments Part of: Cancer Cell Line Factory (CCLF) cell models.
Part of: Cancer Dependency Map project (DepMap) (includes Cancer Cell Line Encyclopedia - CCLE).
Derived from site: In situ; Kidney; UBERON=UBERON_0002113.
Sequence variations
  • Mutation; HGNC; HGNC:11998; TP53; Simple; p.Tyr107_Phe113del (c.320_340delACGGTTTCCGTCTGGGCTTCT); Zygosity=Heterozygous (DepMap=ACH-001163).
Disease Kidney medullary carcinoma (NCIt: C7572)
Renal medullary carcinoma (ORDO: Orphanet_319319)
Species of origin Homo sapiens (Human) (NCBI Taxonomy: 9606)
Sex of cell Male
Age at sampling Children
Category Cancer cell line
Cross-references
Cell line databases/resources Cell_Model_Passport; SIDM01968
DepMap; ACH-001163
Encyclopedic resources Wikidata; Q110432682
Entry history
Entry creation16-Dec-2021
Last entry update19-Dec-2024
Version number7