Cellosaurus logo
expasy logo

Cellosaurus GM28024 (CVCL_B0I0)

[Text][XML][JSON]
Cell line name GM28024
Accession CVCL_B0I0
Resource Identification Initiative To cite this cell line use: GM28024 (RRID:CVCL_B0I0)
Comments Population: Caucasian.
Derived from site: In situ; Skin; UBERON=UBERON_0002097.
Cell type: Fibroblast of skin; CL=CL_0002620.
Sequence variations
  • Mutation; HGNC; HGNC:21308; ELOVL5; Simple; c.246+3891C>T (p.Gln102Ter, c.304C>T); ClinVar=VCV000691282; Zygosity=Heterozygous (Coriell=GM28024).
  • Mutation; HGNC; HGNC:11474; SURF1; Simple; p.Met1_Ala5del (c-11_13delGGCCGGGTGCGATGGCGGCGGTGG) (c.-13_11del24); ClinVar=VCV000215241; Zygosity=Heterozygous (Coriell=GM28024).
  • Mutation; HGNC; HGNC:11474; SURF1; Simple; p.Leu105Ter (c.312_321del10insAT) (p.Pro104_Leu105insTer); ClinVar=VCV000215237; Zygosity=Heterozygous (Coriell=GM28024).
Disease Leigh disease (NCIt: C84814)
Mitochondrial complex IV deficiency, nuclear type 1 (NCIt: C176895)
Leigh syndrome (ORDO: Orphanet_506)
Species of origin Homo sapiens (Human) (NCBI Taxonomy: 9606)
Sex of cell Female
Age at sampling 15Y
Category Finite cell line
Cross-references
Cell line collections (Providers) Coriell; GM28024
Encyclopedic resources Wikidata; Q108820296
Entry history
Entry creation23-Sep-2021
Last entry update19-Dec-2024
Version number7