ID   ESi047-A
AC   CVCL_VD53
SY   GLC-FiPS4F1
DR   hPSCreg; ESi047-A
DR   SKIP; SKIP003169
DR   Wikidata; Q54832805
RX   PubMed=29453128;
CC   Part of: Spanish Stem Cell Bank (Banco Nacional de Lineas Celulares) collection.
CC   From: Centro de Medecina Regenerativa de Barcelona (CMRB); Barcelona; Spain.
CC   Sequence variation: Mutation; HGNC; 2597; CYP1B1; Simple; p.Lys468_Ser476dup (c.1403_1429dupAGAAAGTTCTTCGCCAATGCACCGCCT); dbSNP=rs72549373; Zygosity=Homozygous (PubMed=29453128).
CC   Derived from site: In situ; Skin, dermis; UBERON=UBERON_0002067.
CC   Cell type: Fibroblast of skin; CL=CL_0002620.
DI   NCIt; C148260; Primary congenital glaucoma 3A
DI   ORDO; Orphanet_98976; Congenital glaucoma
OX   NCBI_TaxID=9606; ! Homo sapiens (Human)
SX   Male
AG   38Y
CA   Induced pluripotent stem cell
DT   Created: 14-05-18; Last updated: 29-06-23; Version: 12
//
RX   PubMed=29453128; DOI=10.1016/j.scr.2018.01.004;
RA   Bolinches-Amoros A., Lukovic D., Castro A.A., Leon M., Kamenarova K.,
RA   Kaneva R., Jendelova P., Blanco-Kelly F., Ayuso C., Corton M.,
RA   Erceg S.;
RT   "Generation of a human iPSC line from a patient with congenital
RT   glaucoma caused by mutation in CYP1B1 gene.";
RL   Stem Cell Res. 28:96-99(2018).
//