ID   MM1.R(E)
AC   CVCL_8793
SY   MM1.RE
DR   cancercelllines; CVCL_8793
DR   Wikidata; Q54906037
RX   PubMed=12691914;
CC   Population: African American.
CC   Characteristics: Produces IgA lambda (from parent cell line).
CC   Characteristics: Resistant to dexamethasone.
CC   Sequence variation: Mutation; HGNC; HGNC:6407; KRAS; Simple; p.Gly12Ala (c.35G>C); ClinVar=VCV000045122; Zygosity=Heterozygous (from parent cell line).
CC   Sequence variation: Mutation; HGNC; HGNC:12033; TRAF3; Simple; p.Val536_Asn545delValPheValAlaGlnThrValLeuGluAsninsAsp (c.1604-1630delTCTTTGTGGCCCAAACTGTTCTAGAAA); Zygosity=Homozygous (from parent cell line).
CC   Derived from site: In situ; Peripheral blood; UBERON=UBERON_0000178.
CC   Cell type: B-cell; CL=CL_0000236.
DI   NCIt; C3242; Plasma cell myeloma
DI   ORDO; Orphanet_29073; Multiple myeloma
OX   NCBI_TaxID=9606; ! Homo sapiens (Human)
HI   CVCL_5801 ! MM.1
SX   Female
AG   45Y
CA   Cancer cell line
DT   Created: 06-06-12; Last updated: 19-12-24; Version: 17
//
RX   PubMed=12691914; DOI=10.1016/S0301-472X(03)00023-7;
RA   Greenstein S., Krett N.L., Kurosawa Y., Ma C.-G., Chauhan D.,
RA   Hideshima T., Anderson K.C., Rosen S.T.;
RT   "Characterization of the MM.1 human multiple myeloma (MM) cell lines:
RT   a model system to elucidate the characteristics, behavior, and
RT   signaling of steroid-sensitive and -resistant MM cells.";
RL   Exp. Hematol. 31:271-282(2003).
//