Cellosaurus logo
expasy logo

Cellosaurus ID00084 (CVCL_2Z34)

[Text version]
Cell line name ID00084
Accession CVCL_2Z34
Resource Identification Initiative To cite this cell line use: ID00084 (RRID:CVCL_2Z34)
Comments Part of: US Immunodeficiency Network (USIDNET) cell repository.
Transformant: NCBI_TaxID; 10376; Epstein-Barr virus (EBV).
Derived from site: In situ; Peripheral blood; UBERON=UBERON_0000178.
Sequence variations
  • Mutation; HGNC; 10031; RMRP; Simple; n.-24_-4dupACTACTCTGTGAAGCTGAGGA (n.-24_-4dup21) (g.-25_-5dup); ClinVar=VCV000632969; Zygosity=Heterozygous (Coriell=ID00084).
  • Mutation; HGNC; 10031; RMRP; Simple; n.147G>A (146G>A); ClinVar=VCV000379208; Zygosity=Heterozygous (Coriell=ID00084).
Disease Cartilage hair hypoplasia (NCIt: C61245)
Cartilage-hair hypoplasia (ORDO: Orphanet_175)
Species of origin Homo sapiens (Human) (NCBI Taxonomy: 9606)
Sex of cell Male
Age at sampling 2Y
Category Transformed cell line
Cross-references
Cell line collections (Providers) Coriell; ID00084
Encyclopedic resources Wikidata; Q54897290
Entry history
Entry creation22-Sep-2015
Last entry update30-Jan-2024
Version number13